ID: 936394943

View in Genome Browser
Species Human (GRCh38)
Location 2:112118414-112118436
Sequence GGTGGGTCTCACTGTTAGTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936394934_936394943 23 Left 936394934 2:112118368-112118390 CCTCTGAGGCACTCAAATCAGTT 0: 1
1: 0
2: 0
3: 7
4: 113
Right 936394943 2:112118414-112118436 GGTGGGTCTCACTGTTAGTGAGG 0: 1
1: 0
2: 1
3: 7
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936394943 Original CRISPR GGTGGGTCTCACTGTTAGTG AGG Exonic
901733789 1:11299223-11299245 GGTGGCTCTCACTGTGACTGTGG - Intergenic
908694854 1:66827463-66827485 GATGGGTCTCACTGTTACCCAGG - Intronic
910747756 1:90591725-90591747 GCTTGGTCTCACTTTCAGTGGGG - Intergenic
912060798 1:105666206-105666228 GGTGGTTCTAACTTATAGTGTGG - Intergenic
913187974 1:116387397-116387419 GGGGGTTCTCAATGTTACTGTGG + Exonic
920491913 1:206422724-206422746 GGTTGGGCTCACTGTTGGAGGGG + Intronic
1064844813 10:19640033-19640055 GGTGGGCCTCACAGTCAATGGGG - Intronic
1065699919 10:28414849-28414871 GGTGGGTCTCAAGGATAGTGTGG - Intergenic
1069466640 10:68645559-68645581 GGTGGCTCTCCCTGTAAGTTTGG - Exonic
1076097018 10:127740000-127740022 TGTGGGTGTCAGTGTGAGTGTGG - Exonic
1076097022 10:127740030-127740052 TGTGGGTGTCAGTGTGAGTGTGG - Exonic
1080240477 11:30121825-30121847 GCTGGGTATCACTGTGATTGTGG - Intergenic
1083647570 11:64181495-64181517 GCTGGATCTCAGTGTAAGTGGGG - Intergenic
1086845517 11:91744844-91744866 GGTGGTTCTGAAGGTTAGTGGGG - Intergenic
1092480011 12:8851319-8851341 GGTGAGTCTCAGTGTGAGTGAGG - Intronic
1101623872 12:106419207-106419229 GCTGGGTCTCACTGTAAGAAAGG + Intronic
1104986403 12:132600049-132600071 GCTTGTTCTCACTGTTAGGGTGG + Intergenic
1112189866 13:97165645-97165667 GTTGAGTGTCTCTGTTAGTGCGG - Intergenic
1122278653 14:100608887-100608909 GGGGGGTCCCACTGCTGGTGAGG - Intergenic
1124921156 15:34028085-34028107 GGGGGGTCTCTCTGTGTGTGGGG - Intronic
1125214999 15:37262020-37262042 GCTGGGTCTCACAATTAGGGAGG + Intergenic
1130276002 15:82476662-82476684 GGTGAGCCTCACTGATAGCGTGG - Intergenic
1130468363 15:84204054-84204076 GGTGAGCCTCACTGATAGCGTGG - Intergenic
1130495903 15:84469488-84469510 GGTGAGCCTCACTGATAGCGTGG + Intergenic
1130590656 15:85208652-85208674 GGTGAGCCTCACTGATAGCGTGG - Intergenic
1131024638 15:89129651-89129673 GGTGGGTCTCACTGCTGATCTGG - Intronic
1136319262 16:29471953-29471975 GGTGGGTCTCTCCCTAAGTGCGG - Intergenic
1136433833 16:30211297-30211319 GGTGGGTCTCTCCCTAAGTGCGG - Intergenic
1137501383 16:49014133-49014155 GGTGGGTCTCATTGTTAGTAGGG - Intergenic
1137643672 16:50056064-50056086 GGTGGGTACCACTGACAGTGTGG - Intergenic
1138467955 16:57207335-57207357 TGTGGGTCTCTGTTTTAGTGTGG - Intronic
1139967357 16:70753255-70753277 GGTGGGTCTCATTAGCAGTGGGG + Intronic
1142149679 16:88507101-88507123 GGTGGGATTCACTGCAAGTGGGG + Intronic
1143474385 17:7194347-7194369 CGTCGGTCTCACTGTCAGAGTGG + Exonic
1151784663 17:76269682-76269704 GGTGGCTGTCACCCTTAGTGTGG + Intronic
1155249594 18:23941929-23941951 GGTGTGTCTGTGTGTTAGTGCGG - Intronic
1157056228 18:44232255-44232277 GGTGAGTGTCACTGTTAGAAAGG - Intergenic
1163444583 19:17339026-17339048 GGTGGGTCTACCTGGTGGTGGGG + Exonic
1164554626 19:29241754-29241776 GCTGGGTCACACTGATGGTGTGG - Intergenic
1166067388 19:40367834-40367856 TGTGGGTGTCATTGTTGGTGAGG - Exonic
1168131267 19:54321023-54321045 TCTGGGTCTCACTATTTGTGTGG + Intergenic
926052578 2:9754207-9754229 GGTGGGGCTCAGAGTTAATGGGG + Intergenic
930554898 2:52883315-52883337 GGTGGATGTCACTGTGAATGTGG + Intergenic
930583454 2:53241866-53241888 AGTGGTTGTCAGTGTTAGTGGGG - Intergenic
930742093 2:54842008-54842030 GGTGGGGCACATTGATAGTGAGG - Intronic
933823750 2:86139609-86139631 GGGGGGTCTCACTGTTACCCAGG - Exonic
934877002 2:97931875-97931897 GGAGGGCCACACTGTGAGTGGGG - Intronic
936394943 2:112118414-112118436 GGTGGGTCTCACTGTTAGTGAGG + Exonic
943958853 2:194232578-194232600 ACTAGGTCTCACTGTCAGTGTGG + Intergenic
945697836 2:213130489-213130511 GGTGGGTCTTAAGGTTGGTGGGG - Intronic
946717193 2:222565065-222565087 GATGGGTGCCACTGTGAGTGGGG + Intergenic
1169925331 20:10777764-10777786 GGTGGGGCTCACTGTTGCTGGGG + Intergenic
1173607843 20:44344414-44344436 GGTGGGTCTCACTGTCACCCAGG - Intronic
1173666677 20:44768068-44768090 GTTGGGTCGCTCTGTCAGTGAGG - Intronic
1173903917 20:46612151-46612173 ACAGGGTCTCACTGTTACTGAGG + Intronic
1173943738 20:46933552-46933574 GGTGGGTCACTCTGTTATTGAGG + Intronic
1176430457 21:6572191-6572213 TGTGGGTGTCCCTGTGAGTGGGG + Intergenic
1179084387 21:38204534-38204556 GCTGTGTCTCACTGTGACTGTGG + Intronic
1179705851 21:43179653-43179675 TGTGGGTGTCCCTGTGAGTGGGG + Intergenic
1183705344 22:39472208-39472230 GTTGGGTCTCTCTGGGAGTGGGG - Intronic
1184118822 22:42437582-42437604 AGTGGGTGGCACCGTTAGTGGGG - Intergenic
1184183854 22:42850545-42850567 GCAGGGTCTCACTGTTGCTGAGG - Intronic
1184326888 22:43795084-43795106 GGTGGGTCTTACAGTGTGTGAGG - Intronic
949547532 3:5084609-5084631 GCTGGGTCTCTCTGAGAGTGTGG - Intergenic
949836583 3:8276699-8276721 TCTTGGTCTCACTGTTATTGAGG + Intergenic
955754701 3:62215694-62215716 GGTGGTTCTCACTTTTTCTGGGG + Intronic
955781679 3:62491236-62491258 TATGGGTTTCACTGTTATTGTGG - Intronic
959581641 3:107988659-107988681 GGCAGGGCTCACTGCTAGTGAGG - Intergenic
959724676 3:109529853-109529875 GGAGGGACTCACAGTTAATGAGG + Intergenic
961382510 3:126505064-126505086 GGTGGGTCACACGGTGAGAGAGG - Intronic
961747643 3:129075495-129075517 GGTGGGTCACACGGTGAGAGAGG + Intergenic
964745824 3:160011440-160011462 AGTGGGGCTCACAGTGAGTGTGG - Intergenic
974699650 4:65424052-65424074 GGTGGGACTCACCATTAGAGTGG - Intronic
974803739 4:66853468-66853490 GGTGGGTATCATAGTCAGTGTGG + Intergenic
987007223 5:13723001-13723023 GGTGAGCCTCTCTGTGAGTGAGG - Intronic
988964507 5:36402854-36402876 TGGGGGTCTTGCTGTTAGTGAGG + Intergenic
993682167 5:90893111-90893133 GGTTGCTCTCACTATCAGTGAGG + Intronic
999450548 5:151674515-151674537 TGTGGGTCTCAATGCTAGAGTGG - Intronic
1001523093 5:172409188-172409210 AGGGGGTTTCACTGTTAGTCAGG - Intronic
1003294427 6:4811815-4811837 GATGGGTCTCACTGTTACCCGGG + Intronic
1010065569 6:71679105-71679127 TGTGGGTCCCACTGGTACTGAGG - Intergenic
1011218615 6:85031655-85031677 GGTGGGTCTCACTGAGAAGGTGG + Intergenic
1012912104 6:105129723-105129745 GGTGGGTAACACAGATAGTGGGG + Intronic
1013750365 6:113399014-113399036 GGTGGGAATCACTGTAAATGGGG - Intergenic
1017440991 6:154464206-154464228 GCTGGGACTGACTGTTAGGGTGG + Intronic
1019699074 7:2464304-2464326 GGGGGGTCTCACTGTTTCTCAGG + Intergenic
1026650507 7:72212157-72212179 GATGGGTTTCACTGTTAGCCAGG - Intronic
1030640565 7:112001395-112001417 GGTGGGTAGCACTGACAGTGTGG - Intronic
1032132320 7:129240292-129240314 GGTGGGTCTCAGGGTGTGTGTGG - Intronic
1036235682 8:7037450-7037472 GGTGTGTCTCACTGTTGCCGAGG + Intergenic
1038197139 8:25378785-25378807 GGTGGGTTTCCCCGATAGTGTGG - Intronic
1043965513 8:86470348-86470370 AATGGGTCTCACCCTTAGTGGGG + Intronic
1047099551 8:121661644-121661666 GCAGGGTCTCACTGTCACTGAGG + Intergenic
1047701910 8:127457183-127457205 GGTGGGAATCACTGTGGGTGGGG - Intergenic
1048302282 8:133260407-133260429 GGTGGGACCCACTGTCAGAGTGG - Intronic
1050597107 9:7215035-7215057 GGTCAGTCTCACTGTCATTGTGG - Intergenic
1051302342 9:15665150-15665172 GGAAGGTCTCACTGTTAATCAGG + Intronic
1053278019 9:36797933-36797955 TGTCGGGCTCACTGTTGGTGGGG + Intergenic
1054764678 9:69033687-69033709 GAAGGGCCTCACTGTTGGTGTGG + Intergenic
1055550905 9:77431527-77431549 TGTGGGGCTCACTGTGAGTGGGG - Intronic
1058047700 9:100374442-100374464 GCTGGATCTCACTGTTTGTTAGG + Intergenic
1058942215 9:109823665-109823687 GTTGGCTCTCCCTGTTACTGTGG + Intronic
1190630070 X:52377720-52377742 GGTGGGTCTCTCTGCCTGTGAGG + Intergenic
1190636094 X:52435485-52435507 GGTGGGTCTCTCTGCCTGTGAGG + Intergenic
1190638925 X:52464489-52464511 GGTGGGTCTCTCTGCCTGTGAGG + Intergenic
1190680179 X:52820082-52820104 GGTGGGTCTCTCTGCCTGTGAGG + Intergenic
1190684035 X:52854265-52854287 GGTGGGTCTCTCTGCTTGTGAGG - Intergenic
1190999915 X:55648647-55648669 GGTGGGTCTCTCTGCCTGTGAGG - Intergenic
1195272229 X:103243114-103243136 GGTGGGTCTCTCTGTGTGTATGG - Intergenic
1196900751 X:120380464-120380486 GGTGGGGCTCACTGCAACTGGGG + Exonic
1198828334 X:140721744-140721766 GGTGTGTCTTAATGTTATTGAGG - Intergenic
1202367320 Y:24174253-24174275 GGTGAGCCTCACTGGTAGCGTGG + Intergenic
1202372751 Y:24209599-24209621 GGTGAGCCTCACTGATAGCGTGG - Intergenic
1202498031 Y:25460521-25460543 GGTGAGCCTCACTGATAGCGTGG + Intergenic
1202503461 Y:25495870-25495892 GGTGAGCCTCACTGGTAGCGTGG - Intergenic