ID: 936396788

View in Genome Browser
Species Human (GRCh38)
Location 2:112137788-112137810
Sequence GTCTGAAGTCCCCTGCCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936396788_936396790 -6 Left 936396788 2:112137788-112137810 CCTGATGGCAGGGGACTTCAGAC 0: 1
1: 0
2: 1
3: 10
4: 137
Right 936396790 2:112137805-112137827 TCAGACTGCTCATGCCGGCCTGG 0: 1
1: 0
2: 0
3: 7
4: 83
936396788_936396793 20 Left 936396788 2:112137788-112137810 CCTGATGGCAGGGGACTTCAGAC 0: 1
1: 0
2: 1
3: 10
4: 137
Right 936396793 2:112137831-112137853 TTCCTGATTCGACTTCAGCAAGG 0: 1
1: 0
2: 0
3: 26
4: 80
936396788_936396795 24 Left 936396788 2:112137788-112137810 CCTGATGGCAGGGGACTTCAGAC 0: 1
1: 0
2: 1
3: 10
4: 137
Right 936396795 2:112137835-112137857 TGATTCGACTTCAGCAAGGCAGG 0: 1
1: 0
2: 0
3: 3
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936396788 Original CRISPR GTCTGAAGTCCCCTGCCATC AGG (reversed) Intergenic
903741601 1:25561798-25561820 ATCTGAACACCCCTGCCCTCGGG - Intronic
904762874 1:32817963-32817985 GTCTGCAGTCCCCTGCCCAGTGG + Exonic
905295576 1:36952284-36952306 GTCTTCAGTCCCCTCCCCTCTGG + Intronic
905360891 1:37419590-37419612 GTCTTAAGTCCACTCCCTTCAGG - Intergenic
915118659 1:153615381-153615403 TTGTGATGTCCCCTGCCCTCAGG - Exonic
916322766 1:163523146-163523168 GTGTGGAGTGCCCTGCCTTCAGG + Intergenic
917805230 1:178607155-178607177 GTCTGAAGTGCCCTCCCTACTGG + Intergenic
917854720 1:179091159-179091181 GCCTGAAGTCCCCTTCCTTTGGG + Intronic
918377877 1:183927251-183927273 GTCTGGAGTCTTTTGCCATCTGG + Exonic
920307991 1:205031204-205031226 GTCTGCTGTCCCTTGCCCTCTGG + Intergenic
920427883 1:205892823-205892845 GTCTGTGGTCCCTTGCCAGCAGG + Intergenic
1063651749 10:7945134-7945156 GTCTGAAGTGCACTGGCCTCTGG + Intronic
1067893780 10:50158309-50158331 GTCAGAAGTCATCTCCCATCTGG + Intergenic
1067955066 10:50781959-50781981 GTCAGAAGTCATCTCCCATCTGG - Intronic
1068166579 10:53339555-53339577 GTCTGCAGACCCTTGCCAGCGGG - Intergenic
1068773750 10:60850050-60850072 GCCTGAAGTCACCTCCCAGCTGG - Intergenic
1068817678 10:61336035-61336057 TGCTGAAATCCCTTGCCATCTGG + Intergenic
1070660158 10:78299876-78299898 GTCTGAGCTCTCCTGCCATGAGG - Intergenic
1070989391 10:80718277-80718299 GTCTGACATCCGCTGCCCTCTGG - Intergenic
1071412293 10:85408486-85408508 GACAGAAGTCCACTGCCATGAGG - Intergenic
1074863382 10:117530326-117530348 GTAAGAAGTCCCCTGCCACCAGG - Intergenic
1075589078 10:123678494-123678516 GTCTGATGTCTCCTCCCTTCAGG - Intronic
1076220780 10:128731640-128731662 GTCTCAAAGCCCCTGCCTTCAGG + Intergenic
1076839736 10:133040126-133040148 CTCTGAAGGTCCCTGCCTTCAGG + Intergenic
1077631277 11:3812666-3812688 TTCTGAAGGCCCCAGCCAGCTGG + Intronic
1078187926 11:9068201-9068223 GACAGAAGACCCCTGCCATTTGG - Intronic
1079610368 11:22425719-22425741 GTCTAAAGTCACCTCCCATGAGG + Intergenic
1079745142 11:24117569-24117591 GTCTGTAGTCCCAGGCAATCAGG + Intergenic
1092448384 12:8579619-8579641 GTCTGAAGTCACATGTCATCAGG - Intergenic
1101309215 12:103561146-103561168 GTGTGAAGACCCCTGCCTTGGGG - Intergenic
1104809996 12:131614394-131614416 GTCTGAACCCCCTTCCCATCAGG - Intergenic
1104833125 12:131768466-131768488 GTCTGAAATCCTCTCACATCTGG + Intronic
1106020020 13:25905612-25905634 CTCTGCAGGCCGCTGCCATCTGG + Intronic
1106546157 13:30732567-30732589 GTCTTCATTCTCCTGCCATCTGG + Intronic
1106547079 13:30740064-30740086 TTCTGAAGTCCCTTGCCACTGGG + Intronic
1106579680 13:31006395-31006417 GTATGAAGATCCCTGCCTTCAGG - Intergenic
1111233314 13:85373452-85373474 GTCTGAAAACCACTGCCAACCGG + Intergenic
1112507182 13:99982081-99982103 GTCCGCAGTTCCCGGCCATCGGG + Exonic
1115398835 14:32937174-32937196 GTCAGGAGTCCCCTGTCCTCTGG + Intronic
1118917439 14:70119475-70119497 ATCTGATGTCACCTGCCAGCTGG - Intronic
1119658842 14:76436450-76436472 GGCTGAAGACCCCTGGGATCTGG + Intronic
1120358391 14:83462955-83462977 CTCTGCAGGCCCCAGCCATCAGG + Intergenic
1121319771 14:92985210-92985232 CTCTGTGGTCTCCTGCCATCTGG - Intronic
1127958330 15:63872082-63872104 GGCTGAAGCCCCATGTCATCAGG + Intergenic
1129738056 15:77976668-77976690 GTCTGTGGGCCCCTGCCATGTGG + Intergenic
1129848020 15:78776941-78776963 GTCTGTGGGCCCCTGCCATGTGG - Intronic
1130253896 15:82316995-82317017 GTCTGTGGGCCCCTGCCATGTGG + Intergenic
1132495311 16:260418-260440 GTCCGATGTCACCTGCCATGGGG + Intronic
1132830319 16:1924817-1924839 GTCTTCAGTCCCCTGCCTGCTGG + Intergenic
1132934082 16:2472254-2472276 GCCAGAAGGCCGCTGCCATCAGG - Exonic
1136010743 16:27362141-27362163 GTCTGAAGTAGACAGCCATCAGG + Intronic
1140454061 16:75094337-75094359 TTTTGAAATCCCCTGCCCTCAGG - Intronic
1141271821 16:82547741-82547763 GACTGAAGTCCCCTGCCCTTGGG - Intergenic
1143340867 17:6209874-6209896 GTCTGCAGTCACCTGTCATGTGG - Intergenic
1145802445 17:27696938-27696960 GTCTGCAGACCTCTGCCAGCAGG + Intergenic
1146841603 17:36160274-36160296 GGCTGAACTCTCCTCCCATCAGG + Intergenic
1146853914 17:36248234-36248256 GGCTGAACTCTCCTCCCATCAGG + Intronic
1146869821 17:36372126-36372148 GGCTGAACTCTCCTCCCATCAGG + Intronic
1146877176 17:36423207-36423229 GGCTGAACTCTCCTCCCATCAGG + Intronic
1147072700 17:37972750-37972772 GGCTGAACTCTCCTCCCATCAGG + Intergenic
1147084222 17:38052288-38052310 GGCTGAACTCTCCTCCCATCAGG + Intronic
1147100170 17:38176254-38176276 GGCTGAACTCTCCTCCCATCAGG + Intergenic
1149537339 17:57443020-57443042 CCCTGAAGCCCCCAGCCATCAGG - Intronic
1149598110 17:57875817-57875839 GTCTGAAATCCCTTTCCATCAGG - Intronic
1149845232 17:60005391-60005413 GGCTGAACTCTCCTCCCATCAGG - Intergenic
1149857706 17:60097087-60097109 GGCTGAACTCTCCTCCCATCAGG - Intergenic
1150083115 17:62259291-62259313 GGCTGAACTCTCCTCCCATCAGG + Intergenic
1150161434 17:62901388-62901410 GTCTGAAGTGCCAACCCATCTGG + Intergenic
1150640257 17:66944903-66944925 GTCTCAAGCCACCTGCCACCAGG + Intergenic
1155959110 18:31978685-31978707 GTCTTCAGTCCCCTCCCATGAGG - Intergenic
1161560845 19:4971704-4971726 GTGTGCAGTCCGCTGCCCTCGGG + Intronic
1165940757 19:39413663-39413685 GTCTGCAGGACCCTGGCATCCGG + Intronic
1167499674 19:49837988-49838010 GTCTGGATCCCCCTGCCCTCGGG - Intronic
928498212 2:31857812-31857834 GTCTGTAATCCCCTGCCTTTGGG + Intergenic
933391614 2:81676066-81676088 CTCTGAAGACCCTTGCCATTTGG + Intergenic
936396788 2:112137788-112137810 GTCTGAAGTCCCCTGCCATCAGG - Intergenic
937683623 2:124671040-124671062 GGCTGAACTCCCCTGCCAGTTGG - Intronic
938945986 2:136212514-136212536 ATCTGCTGTCCCCTGCCATCAGG + Intergenic
943332573 2:186577171-186577193 GTCTGAGGACCACTGCCATCTGG - Intergenic
946561908 2:220923483-220923505 GTCTAAAGTCTCCTAGCATCTGG - Intergenic
947388258 2:229614434-229614456 TTCTGAAGTCCTCTACCATTGGG + Intronic
947812028 2:233010800-233010822 GGCTGAAGTCCTCAGCCTTCTGG + Intronic
948014736 2:234678822-234678844 GTCTGCAGTTCCTTGCCATGTGG - Intergenic
948180161 2:235973234-235973256 GTCTGACACCCTCTGCCATCTGG - Intronic
1169183847 20:3595059-3595081 GTTTGAAGTCCCCATCCATGAGG + Intronic
1170188963 20:13625621-13625643 GTCAGAAAGCCCCTGCCATTTGG + Intronic
1170442901 20:16396744-16396766 GTCTGAAGTCACCGACAATCGGG - Intronic
1172714458 20:36952242-36952264 GTCTGAAGTCCCCTCCTGTGTGG - Intergenic
1176101684 20:63367374-63367396 GCCTGAGGTCCCCTGGCAGCAGG - Intronic
1178523384 21:33304349-33304371 GTTTGAATTTCCCTGCCTTCAGG - Intergenic
1180176746 21:46094231-46094253 GTCTGAGCAGCCCTGCCATCTGG - Intergenic
1181175985 22:21036071-21036093 GCCTGCAGTCCCCAGCCATTCGG - Intergenic
1183408077 22:37640072-37640094 GCCTGAAGCCCCCTCCAATCCGG - Intronic
1183603424 22:38853398-38853420 GACTGAGGACCCCTGCCACCCGG + Intergenic
1184191846 22:42900169-42900191 ATCTGAGGACTCCTGCCATCTGG + Intronic
950738677 3:15032239-15032261 TTCTGAAGTCCCATGCAGTCGGG - Intronic
951847904 3:27104082-27104104 ACCTGTAGTCCCCTGCCATGTGG - Intergenic
952463461 3:33554491-33554513 CTCTCCAGTCCCCTGCCCTCTGG - Intronic
961323326 3:126093545-126093567 GTCTGTGGACCCTTGCCATCAGG + Intronic
966041464 3:175494731-175494753 GTCTGCTGTCCCTTACCATCGGG + Intronic
966532579 3:180997344-180997366 CTCTGAAGTCCACTGCCCCCTGG + Intergenic
968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG + Intronic
968721752 4:2211868-2211890 GTTTGCAGACCCCTGCCTTCGGG + Intronic
968896247 4:3405488-3405510 GTCTGCAGTCTCCTTCCATCTGG - Intronic
976328720 4:83803145-83803167 GCCTGAAGACCCCTCCCAACTGG + Intergenic
977883356 4:102232113-102232135 GTCAAATCTCCCCTGCCATCTGG + Intergenic
981911373 4:149985350-149985372 GTTTGAATTCCCCTCCCCTCTGG + Intergenic
986566422 5:9119318-9119340 GTCTGCAGCCCCCAGGCATCTGG + Intronic
986846271 5:11758823-11758845 GTGTGAAGTCTACTGCCATGAGG - Intronic
989315571 5:40074503-40074525 CTCTGTAATCCACTGCCATCTGG - Intergenic
991079938 5:62587934-62587956 ATCAGAAGGCCTCTGCCATCTGG + Intronic
991197648 5:63955211-63955233 TTCAGCAGGCCCCTGCCATCTGG + Intergenic
992316894 5:75565808-75565830 GTCTGTCAACCCCTGCCATCAGG + Intronic
994415366 5:99463111-99463133 GTTTTAAGTCTCTTGCCATCTGG - Intergenic
1000126352 5:158247692-158247714 ATCTGCAGTCCCCTGCCCTCTGG + Intergenic
1000413766 5:160961770-160961792 TTCAGAAGTCCCTTGCCATGGGG + Intergenic
1001139723 5:169134563-169134585 GTGTGATGTTCCCTGCCATCAGG - Intronic
1001447508 5:171797237-171797259 TTCTGTCGTCCCCTGCCCTCAGG - Intergenic
1001652091 5:173323338-173323360 GCCGGAAGTGCCCGGCCATCAGG - Exonic
1001911404 5:175521552-175521574 GTCTCAAGTCTCCCGCCTTCTGG - Intronic
1006852058 6:37105639-37105661 GTCTGAAACCACCTGCAATCTGG - Intergenic
1008171270 6:48210245-48210267 GTCTTAAGTTCCCTGCCTCCAGG - Intergenic
1008665755 6:53714462-53714484 GTCTGAAGTCCCCAGCCATGAGG - Intergenic
1012296949 6:97535891-97535913 ATCTGAAGACACCTGCCAACAGG - Intergenic
1014523824 6:122477685-122477707 GTCTGAAGTCGCTTGAGATCAGG - Intronic
1016549885 6:145267741-145267763 GGCTGCAGTCCCATGCTATCTGG + Intergenic
1017655545 6:156625236-156625258 GTCTAATGTCCTCAGCCATCAGG - Intergenic
1017823655 6:158066164-158066186 GTCTGATGTCCCATGGCTTCTGG + Intronic
1018834833 6:167474874-167474896 GGCTGAGGTCACCTGCAATCTGG - Intergenic
1018986469 6:168641242-168641264 GGCTGATGTCCTCTGCCATCCGG - Intronic
1026165710 7:67907433-67907455 GTTTCAGGTCCCCTGCTATCAGG - Intergenic
1032988390 7:137363600-137363622 ATTTGAAGTCACCTGCCATTTGG - Intergenic
1035363183 7:158327818-158327840 CTCTGAAGTCCCCTCCCTGCAGG + Intronic
1035455995 7:159009152-159009174 GTCAGACGTCCTCTGCCACCAGG - Intergenic
1038444241 8:27592613-27592635 GTAAGAAGTCGCCTGCCAACAGG + Intergenic
1048981075 8:139703646-139703668 CTCTGGAGTCCCCTGCAAGCGGG + Intergenic
1049108371 8:140627721-140627743 TTCAGAAGTCCCCTTCCGTCTGG + Intronic
1056891154 9:90494212-90494234 GTCTGAAATCCCCTTGCATTTGG + Intergenic
1057168238 9:92945024-92945046 GTGGGAAGTCACCTGCCATGTGG + Intergenic
1060442845 9:123657332-123657354 GCCTCAAGTCCCCAGCCACCTGG - Intronic
1060828857 9:126701522-126701544 ATCTGAAGTTACCTGGCATCAGG + Intergenic
1061588348 9:131582913-131582935 GCCTGAAGTCCCCTGTGACCAGG - Intronic
1062371782 9:136242981-136243003 GTCTGACCTCCCTTGCCGTCAGG - Intronic
1191157576 X:57291532-57291554 GACTGAATTCCCCTGCCAGAGGG - Intronic
1197408129 X:126080346-126080368 ATCAGAAGTCCCATGCCAACAGG + Intergenic
1197646290 X:129021217-129021239 GTCTGCAGTTCCTTGCCATGTGG - Intergenic
1200056210 X:153462711-153462733 GTCTGCTGTCCCCTGCTGTCTGG - Intronic
1200691274 Y:6307620-6307642 GGCTGAAGTGGGCTGCCATCTGG - Intergenic
1201043998 Y:9867096-9867118 GGCTGAAGTGGGCTGCCATCTGG + Intergenic