ID: 936399547

View in Genome Browser
Species Human (GRCh38)
Location 2:112155152-112155174
Sequence TTTCTCAGCTTGGAAAAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 370}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936399547 Original CRISPR TTTCTCAGCTTGGAAAAAGG GGG Intronic
901918089 1:12515729-12515751 TTTCAAAGCTTGGATAAAAGCGG + Intergenic
902207940 1:14883498-14883520 GGTCTCACCTTTGAAAAAGGTGG - Intronic
902576679 1:17382318-17382340 TTTCTCCACTTGTAAAATGGGGG + Intronic
905395874 1:37666031-37666053 CTGCTCAGGCTGGAAAAAGGGGG + Intergenic
906690118 1:47787007-47787029 TTTTTCACCTTGGAAACAAGAGG - Intronic
906764256 1:48412594-48412616 GTTCTCAACTTGGGAAGAGGAGG + Intronic
907764659 1:57397135-57397157 TTTCTCAGCTTGTAAAATTTGGG + Intronic
909377634 1:74958102-74958124 TTTCTCAGCATGGTGCAAGGTGG - Intergenic
909603656 1:77486839-77486861 CTTTTCAGCATGGAAAAAGTAGG + Intronic
910168241 1:84350674-84350696 TTTAAGAGCTTGGAAAAAGTGGG + Exonic
911545843 1:99215416-99215438 CTTCTCAGTATGGAAAAAGCAGG - Intergenic
912928340 1:113932690-113932712 TTTCTCATCTCGGAATTAGGGGG + Intronic
915551163 1:156635333-156635355 TCTCTCAGGTGGGAAAACGGCGG - Intergenic
915962502 1:160278909-160278931 GTTCTCAGCCTGGAACAGGGAGG + Exonic
917344162 1:174011695-174011717 TTTCACAGCTTGAAAAATGGAGG - Intronic
919102781 1:193114108-193114130 TTTATCTGCTTGGAATCAGGAGG + Intergenic
919982279 1:202649764-202649786 TTTCACAGCTGGGAAAACTGAGG + Intronic
920228255 1:204453495-204453517 TTTCTCAGTTTGAAAAAATGAGG + Intronic
920921699 1:210302798-210302820 TTTGCCTGCTTGGAAACAGGCGG + Intergenic
921757476 1:218875851-218875873 TTTCTTAGCAAGGCAAAAGGAGG + Intergenic
922866066 1:228862657-228862679 TTCCTCTTCTTAGAAAAAGGAGG - Intergenic
924307151 1:242701574-242701596 TTACTCAGCCTTTAAAAAGGGGG + Intergenic
924738327 1:246779351-246779373 TTTCTGAGCTTGCAGAAACGGGG - Intergenic
1063510842 10:6643831-6643853 TATCTGACCTTGGAGAAAGGAGG + Intergenic
1063663462 10:8048874-8048896 TTTCTCAACCGGGGAAAAGGTGG + Intergenic
1064739341 10:18416288-18416310 TTACTCAGCCTTGAAAAAGAAGG - Intronic
1065688504 10:28309557-28309579 TTTATGAGCTTGTAACAAGGGGG - Intronic
1066070037 10:31798820-31798842 TTTCTAAGAATGGAACAAGGTGG - Intergenic
1066313453 10:34220650-34220672 TTTCACAGCTTAGGAAATGGAGG - Intronic
1069405376 10:68093189-68093211 TTTTACATGTTGGAAAAAGGAGG + Intergenic
1070600887 10:77865576-77865598 TTTCTCATCTTGGAAAACTGGGG - Intronic
1071023076 10:81082243-81082265 TTCCTCAGCTTGGCAGAAGCAGG + Intergenic
1071090645 10:81913896-81913918 TATTTCAGCTTTTAAAAAGGAGG + Intronic
1072810542 10:98458021-98458043 ATTCTGAGCTTGGAGAACGGTGG - Intronic
1073138133 10:101230772-101230794 TTTCTGCCCTTGGAGAAAGGAGG + Intergenic
1073426363 10:103457893-103457915 TTTCTGAGCTTGGAAGCTGGAGG - Intronic
1073689624 10:105793379-105793401 TTTCTTAGCTGGGATAGAGGTGG + Intergenic
1074388821 10:113039295-113039317 TTTCCTAGCTTGGAGGAAGGTGG + Intronic
1074969829 10:118526992-118527014 TTTTTCAGATTAGAAAAATGAGG + Intergenic
1076298507 10:129405821-129405843 TGTCTCAGCTTGTAAATTGGGGG + Intergenic
1076542693 10:131224149-131224171 GGTCTCAGCTGGGAAGAAGGGGG - Intronic
1078151248 11:8761335-8761357 TGTCACCACTTGGAAAAAGGAGG + Intronic
1078396100 11:10983516-10983538 TTTCTTTGCTTGGAAAATGCTGG + Intergenic
1079304079 11:19307261-19307283 TTTCAAAGCTAGAAAAAAGGAGG - Intergenic
1079331049 11:19533403-19533425 TTTGTCAGCCTTGAAGAAGGGGG - Intronic
1080756418 11:35204305-35204327 TTTTTCAGCTAGGAAAATTGTGG - Intronic
1080957357 11:37114892-37114914 TTAATCAGCTTTGAAAAAGAAGG + Intergenic
1080992640 11:37557916-37557938 TTTCACAGCTTGAAAAAAAGGGG - Intergenic
1081473338 11:43398515-43398537 TTTCTCCTCTTGGAGAGAGGTGG + Intronic
1082067570 11:47913263-47913285 TTTCTCAGCTGTAAAAAAGGGGG + Intergenic
1083320013 11:61839938-61839960 TTACTCAGCCTTGAAAAGGGAGG - Intronic
1083789887 11:64977607-64977629 ATTCTCTGCTTTGAAAAACGGGG + Intergenic
1085042606 11:73335296-73335318 TTTCTCTGCCTGTAAAATGGGGG + Intronic
1085486966 11:76872602-76872624 TTTCTCAGTCTGGAAAATGATGG + Intronic
1085688382 11:78646424-78646446 TGCCTGAGGTTGGAAAAAGGTGG - Intergenic
1087181974 11:95150581-95150603 ATTCTCCGCTTGGATAAGGGCGG + Intergenic
1087231118 11:95665798-95665820 TTTCTCAGATTGGAAAATTTTGG - Intergenic
1088508144 11:110546603-110546625 TTTCTCAGCTTGGACAATATTGG - Intergenic
1089369691 11:117946679-117946701 TGTCTGAGCATGGAAAATGGGGG - Intergenic
1090414818 11:126533767-126533789 TTTCACAGATAGGAAAATGGAGG - Intronic
1091605675 12:1949432-1949454 TTTCTCAGCTAGGAAAGCTGTGG - Intronic
1091704435 12:2684185-2684207 TTTCTATGCTGGGGAAAAGGAGG - Intronic
1092073512 12:5653412-5653434 TTGCTCAGCTTATAAAGAGGTGG - Intronic
1092852650 12:12644990-12645012 TTTCTCATCTGTAAAAAAGGGGG + Exonic
1093599965 12:21009943-21009965 TTCCTCAGATTGGAAAAATTTGG + Intergenic
1095971519 12:47905014-47905036 TGTCTCTGCTTGTCAAAAGGCGG - Intronic
1096175826 12:49517960-49517982 ATTCTCATTTTGGAAAAAAGAGG - Intronic
1096462381 12:51829153-51829175 TATCTCAGCCTGGAACAAAGAGG + Intergenic
1096784007 12:54006847-54006869 CTTCCCAGCCTGGAAAAAGGAGG - Intronic
1096815636 12:54200194-54200216 TTTCCCAGATTGGAACATGGTGG - Intergenic
1098342455 12:69466897-69466919 TTTCAAAGCTTGGCAAAGGGTGG + Intergenic
1098932428 12:76435208-76435230 TTATTCAGCTTTGAAAAAGAAGG + Intronic
1098959570 12:76725520-76725542 TATCTCAGCTTGGCACAAGCTGG + Intergenic
1099536162 12:83847631-83847653 TTTCTCTGCTTGGAAAATTGTGG + Intergenic
1100455272 12:94745598-94745620 TTTCTCTGGGTGGAAAAAGCAGG - Intergenic
1100781165 12:98028071-98028093 TTTCCCAGCCTGTAAAAATGGGG + Intergenic
1101250405 12:102928755-102928777 TGTCTCACCAGGGAAAAAGGTGG + Intronic
1101295194 12:103415914-103415936 TTTTTCTTCTTGGAAACAGGAGG - Intronic
1101421722 12:104556298-104556320 TCTCTTAGCTGGGAAAAGGGGGG - Intronic
1101448296 12:104754109-104754131 TTTCCCAGCTTGGAAATAACTGG - Intronic
1101812286 12:108118165-108118187 TTATTCAGCTTGTAAAAAGATGG - Intergenic
1102789484 12:115632838-115632860 TTTCACAGCTGAGAAAACGGAGG + Intergenic
1103762491 12:123261688-123261710 CTTCTCATCTTGTAAAAAGATGG + Exonic
1104869038 12:131981389-131981411 TTTATCATCTTGGAAAAGGGAGG - Intronic
1106846536 13:33743459-33743481 TTTGTTAGCCTGCAAAAAGGTGG - Intergenic
1107170563 13:37337896-37337918 TATCTCAGCTTCGAAAAATTAGG - Intergenic
1107490134 13:40873813-40873835 TTTTTCTCCTTGGACAAAGGTGG - Intergenic
1107840621 13:44452892-44452914 CTTCTCATCTTGTAAAAAGATGG - Intronic
1107895188 13:44955017-44955039 TGTCTCAGCTAGGAAGAAAGTGG - Intronic
1108461823 13:50674653-50674675 CTTCTCTGCTTGGGATAAGGAGG + Intronic
1108985109 13:56576926-56576948 TTTCTCAGGTTTGTCAAAGGTGG - Intergenic
1109408113 13:61927022-61927044 CTTCTCATCTTGTAAAAAGATGG + Intergenic
1110085714 13:71376748-71376770 TTTCAGAGCTTGGAGAAAAGAGG + Intergenic
1110115653 13:71812940-71812962 TTTCACATCTTGCAAAAAGCTGG - Intronic
1111285499 13:86086432-86086454 TTTATCAGCTGGGAAAATAGGGG - Intergenic
1111926997 13:94474506-94474528 TTTCAGAGATTGGAAAATGGAGG + Intronic
1112064492 13:95778496-95778518 TTACTCAGCTTTTAAAAAGCAGG + Intronic
1112841735 13:103587672-103587694 TTTAGCAGCTTGGTAAAAGTAGG + Intergenic
1113231308 13:108216459-108216481 TGTGTCAGTTTTGAAAAAGGAGG - Intronic
1114367390 14:22044417-22044439 TTTCTCAGATTGGGAAACTGAGG + Intergenic
1114465631 14:22920275-22920297 TTTGCCACCTTGGAAAAAGATGG - Intergenic
1114852910 14:26401919-26401941 TCTCTCTGTTTGGAAATAGGAGG + Intergenic
1117058582 14:51937815-51937837 TTTATCAGCTTAGTACAAGGAGG - Intronic
1118826002 14:69381989-69382011 TTTCTCATTTATGAAAAAGGAGG - Intronic
1118973776 14:70659914-70659936 TTTTTCAGATAGGAAAATGGAGG - Intronic
1120557673 14:85949069-85949091 CTTCTCAGGTTTGAAAAAAGAGG - Intergenic
1121545537 14:94760516-94760538 TTTCTCATTTTGGAAAGAAGGGG + Intergenic
1122295383 14:100702774-100702796 TTACTCAGCCTGGAAAAGGAAGG - Intergenic
1122466264 14:101935650-101935672 ATTCTCCGCTTGAAAAAAGTCGG + Intergenic
1123133802 14:106009493-106009515 TATCTAAGCATGGAAAAATGCGG + Intergenic
1125484263 15:40101516-40101538 TTTCTCTGCCTGCAAAAATGAGG + Intronic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1126991832 15:54386970-54386992 TTTATCAGCTAGGAAAATAGAGG - Intronic
1127998078 15:64166369-64166391 TTTCTCTGCTTGATAAAATGGGG + Exonic
1128044357 15:64604500-64604522 TTTGTCAGCTAGGATAGAGGTGG + Intronic
1131875539 15:96802358-96802380 TTTCCCCTCTTTGAAAAAGGGGG - Intergenic
1133407652 16:5538284-5538306 TTTCTTAGCTTTTAAAATGGAGG + Intergenic
1133908777 16:10045773-10045795 TCCATCAGCTTGGAAAAGGGTGG - Intronic
1134332228 16:13261521-13261543 TTCATCAGCTTGGAAAGAGCTGG - Intergenic
1136068149 16:27772288-27772310 TTTCACAGCTAGGAAAACTGAGG + Intronic
1137469048 16:48738209-48738231 TTTCTCAGATAGGAAAACTGAGG - Intergenic
1138074640 16:54029487-54029509 TCTCTCAACTAGAAAAAAGGGGG - Intronic
1138411472 16:56843894-56843916 TTGTTCAGGATGGAAAAAGGTGG - Intronic
1138472885 16:57252154-57252176 TTTCTCATATAGGAAAAAGAAGG + Exonic
1138947298 16:61867022-61867044 TCTCTCACATTGGAAAAGGGAGG - Intronic
1139288061 16:65833124-65833146 TTTCTCAGGTTGCAAGAGGGTGG + Intergenic
1140339360 16:74141724-74141746 TTGCTCAGCTTGGAAAGCAGTGG - Intergenic
1140935901 16:79669976-79669998 TTTCTCAACTTGGCATATGGTGG + Intergenic
1140974116 16:80043000-80043022 TGTGTCAGCTTGCAAATAGGAGG - Intergenic
1141380704 16:83574063-83574085 TTTCGCAGCTGGGAAAATTGAGG - Intronic
1144300355 17:13917665-13917687 TTTCTCAGCTCTGAAATGGGAGG - Intergenic
1146496750 17:33329479-33329501 TTTCTCATTTGTGAAAAAGGAGG - Intronic
1146615933 17:34357407-34357429 TTTCTCAGCTTGAATACAGCAGG - Intronic
1148758579 17:49987574-49987596 TTTATCAGGTGGGAAAACGGAGG - Intergenic
1149091409 17:52786899-52786921 TTTCTCAACTTTGTAAAATGGGG + Intergenic
1150310234 17:64122271-64122293 TTTCTCAGCTTGGGAGAGGAGGG + Intronic
1150588615 17:66540894-66540916 TTTCTCAGCTGAGAAAAGGGAGG - Intronic
1150649920 17:67003243-67003265 TTTCACAGATGGGAAAAATGAGG + Intronic
1151650306 17:75464118-75464140 TTTCTGAGCTTGGCAGCAGGAGG + Intronic
1152455651 17:80414778-80414800 CTTCTGCGCTTGGAAAAGGGTGG - Intergenic
1152652340 17:81500585-81500607 TTTCTCAGCTTTAAAAAGGAAGG + Intergenic
1153202654 18:2661761-2661783 TTTGACAGCTAGGAAATAGGGGG + Intronic
1153292267 18:3513205-3513227 TTATTCAGCTTTGAAAAAGAAGG - Intronic
1154005596 18:10525026-10525048 TTTCCTGGCTTGGAGAAAGGAGG + Intergenic
1154337548 18:13477641-13477663 TTTCTCAGCTATGAAAAGAGGGG - Intronic
1154341965 18:13510954-13510976 TTTATCTGCTTGGAAAAAAATGG + Intronic
1156576676 18:38325135-38325157 TTTCTTGGCTTTGAAAATGGAGG + Intergenic
1157403778 18:47407064-47407086 ATTCTCAGCATGGAGAAAGTGGG - Intergenic
1158087689 18:53672435-53672457 TTTGTCAGCATGAAAAAAGCTGG - Intergenic
1158956855 18:62548620-62548642 TTTCTTTGTTTGGAAAATGGAGG + Intronic
1159544330 18:69820060-69820082 TTACTCAGCCTTAAAAAAGGAGG - Intronic
1160161068 18:76471464-76471486 TTTCACAGATGGGAAAAACGAGG - Intronic
1160796076 19:946032-946054 TTTCTCAGCAGGGAAAAATGAGG + Intronic
1160903703 19:1442035-1442057 TCTCTCTGTTTGGGAAAAGGTGG + Intergenic
1161197735 19:2996404-2996426 CTTCATAGCTTGGAAAAGGGAGG - Intergenic
1162531544 19:11239045-11239067 TTTCCCTGCTTGTAAAATGGCGG - Intronic
1162785140 19:13030084-13030106 TTTCTGGGCCTTGAAAAAGGAGG - Intronic
1163040039 19:14595259-14595281 ATTCACAGCTGGGAGAAAGGGGG - Exonic
1163168249 19:15512203-15512225 TTTCACAGATTGGCAAAGGGAGG + Intronic
1165446667 19:35860511-35860533 TTCCTCAGGTGGGCAAAAGGGGG + Exonic
1165869618 19:38962048-38962070 TTTCGCAGCTTAGAACAATGAGG - Intronic
1166552638 19:43676574-43676596 TTTCTCTGCCTGGAAAACGGGGG - Intergenic
1166804738 19:45478960-45478982 CTTTTCATTTTGGAAAAAGGGGG - Intergenic
1166807471 19:45496202-45496224 TTCCTCAGCTGGGGAATAGGAGG + Intronic
925273685 2:2634002-2634024 TTACTCAGCCTTGATAAAGGAGG - Intergenic
926372471 2:12193787-12193809 TTATTCAGCTTTGAAAAAGAAGG - Intergenic
926450727 2:13000768-13000790 CTTCCAAGCATGGAAAAAGGAGG + Intergenic
926812066 2:16764122-16764144 TTTTTCTGATTGGAAAAAGGGGG - Intergenic
927804556 2:26134736-26134758 TTTCACAGCTTGGAGGAAGCAGG + Intronic
928174251 2:29023346-29023368 TTTCTCAGATTGGAAAACTGAGG + Intronic
928687024 2:33760375-33760397 TGTCTTAGCCTGGAGAAAGGTGG + Intergenic
929045093 2:37781323-37781345 CTTCACAGCTTCTAAAAAGGGGG - Intergenic
929787862 2:45004983-45005005 TTTCCCAGCCAGGAAAAGGGAGG + Intergenic
929869628 2:45747542-45747564 TTACTCAGCCTTAAAAAAGGAGG - Intronic
930260944 2:49145221-49145243 CTTTTCAGTTTGGATAAAGGAGG - Intronic
930531750 2:52597167-52597189 TTTCTCATGTTGACAAAAGGTGG - Intergenic
931337524 2:61362470-61362492 TTATTCAGCTTTTAAAAAGGAGG + Intronic
932164137 2:69490703-69490725 TTTCACAAGTTGAAAAAAGGTGG + Intronic
936399547 2:112155152-112155174 TTTCTCAGCTTGGAAAAAGGGGG + Intronic
936773556 2:115944503-115944525 TCTCTCTGCTTTGAAAATGGAGG + Intergenic
939331725 2:140772199-140772221 TACATCAGCTTGGAAAAATGTGG - Intronic
939491743 2:142884865-142884887 TTCCTGAGGTTGGGAAAAGGTGG - Intronic
939691737 2:145270769-145270791 TTTCTCCTCTTGAAAAAAGTTGG + Intergenic
939884589 2:147667185-147667207 TTTCATGGCTTGGATAAAGGTGG - Intergenic
940470817 2:154097934-154097956 TTTCTCAGCTTTAAAAATGCAGG - Intronic
941046446 2:160681108-160681130 TTACTCAGCTTTTAAAAAGAAGG - Intergenic
942290426 2:174464168-174464190 TTTCTCAGTTTGCAAAATGAAGG + Intronic
942496627 2:176547013-176547035 TTTCTCCTCCTGGAAAATGGTGG + Intergenic
943150774 2:184109797-184109819 TTGCTCAGGTTGGAAACAAGGGG - Intergenic
943758592 2:191584745-191584767 TTTCTCAGATGGAGAAAAGGAGG + Intergenic
943859523 2:192843013-192843035 TATCTCACCATGGAAAAGGGTGG + Intergenic
943996984 2:194781826-194781848 TTTCTCAGGAAGGAAGAAGGAGG + Intergenic
944681474 2:202081182-202081204 TTACTCAGCTTTGCAAAAGAAGG - Intronic
945049098 2:205806577-205806599 TTTGGCTGCTTTGAAAAAGGAGG - Intergenic
946831725 2:223734719-223734741 TTTCACATCTTGGAAAATAGTGG + Intergenic
947866474 2:233401165-233401187 TTTCTCAGATGAGAAAATGGAGG - Intronic
1169218502 20:3807045-3807067 TTTTTCAGATGGGAAAATGGAGG + Intergenic
1169349246 20:4854906-4854928 TTTCTCTGCTCTGAAAAATGGGG - Exonic
1169818864 20:9687142-9687164 TTGCTCAGGATGGAAAAAAGAGG + Intronic
1170088889 20:12568082-12568104 TTTTTCACCTTTGAAAAAAGAGG - Intergenic
1170709264 20:18775406-18775428 TATTTCAGCTTGAGAAAAGGAGG - Intergenic
1171287912 20:23957303-23957325 TTTCCCTGTTTGGAGAAAGGTGG - Intergenic
1171342474 20:24441270-24441292 GGTCCCAGTTTGGAAAAAGGCGG - Intergenic
1173766091 20:45610875-45610897 TCTCTCAACTTGGAATTAGGAGG - Intronic
1173768630 20:45637698-45637720 TTACTCAGCTTTTAAAAAGAAGG - Intergenic
1173854890 20:46243871-46243893 TTTCTCAGGTTAGAAAACTGAGG + Intronic
1174395320 20:50243430-50243452 TTTCTCAGCTGGGGAAACTGAGG - Intergenic
1174582581 20:51582645-51582667 TTTCTCAACTTGAATAAAGATGG + Intergenic
1174970243 20:55267165-55267187 TGTCCCAGCTTGAGAAAAGGGGG + Intergenic
1175169736 20:57071826-57071848 TTTCTCAGCTGTAAAATAGGAGG - Intergenic
1178989817 21:37343449-37343471 TTTCTCATCTGTGAAAAAGATGG - Intergenic
1179433535 21:41343592-41343614 TTCCAAAGCATGGAAAAAGGAGG + Intronic
1179464736 21:41564046-41564068 TTTCTCTGTTTAGTAAAAGGTGG + Intergenic
1181662648 22:24364046-24364068 TTTCTCACCTCAGAAGAAGGTGG - Intronic
1182043503 22:27256930-27256952 TTTCTCAGCTGGGAAAACTGAGG + Intergenic
1182357299 22:29727968-29727990 TTTCTCAGCCTGGAGAATTGAGG + Intronic
1182943541 22:34300824-34300846 TTTCTCAGGTAAGAAAATGGAGG - Intergenic
1183018101 22:35006503-35006525 TTTCTCTTCTTGGCATAAGGGGG - Intergenic
1183363494 22:37395164-37395186 TTTCTCAGATGAGAAAACGGAGG + Intronic
1184159875 22:42691884-42691906 TTTGTGAGCCTTGAAAAAGGAGG + Intergenic
1184542212 22:45133779-45133801 TTTCTGAGCAAGGAAAAAGAAGG + Intergenic
1184959024 22:47915389-47915411 ATTCTCAGATTAGAAAACGGAGG + Intergenic
949159598 3:864559-864581 TTTTTCAGCCTTGAAAAAGAAGG - Intergenic
949263107 3:2125296-2125318 TTACTCAGCCTTGAAAAAGAAGG - Intronic
949755032 3:7399493-7399515 TTTCACAGATGGGAAAAATGAGG - Intronic
949841011 3:8319978-8320000 CTTCTATGCTTGGAAGAAGGGGG - Intergenic
951529884 3:23688298-23688320 TTTCTCAGCCTGGTTCAAGGGGG + Intergenic
951697998 3:25466032-25466054 TTTCTCATCTGGAAAAATGGGGG + Intronic
952647996 3:35685294-35685316 TTTCTGAGCTTGGAACCAGCAGG - Intronic
953160899 3:40417880-40417902 TCACTCACCCTGGAAAAAGGAGG - Intronic
953577215 3:44122705-44122727 TCTCTCATCTTGGAAACAAGAGG - Intergenic
955199688 3:56839829-56839851 TTCCTCAGGTGGGTAAAAGGTGG - Intronic
957163923 3:76646223-76646245 TTGCTGAGCTAGGAAGAAGGAGG + Intronic
958161386 3:89819681-89819703 TTTCTCAGCTTGGATATTGTTGG - Intergenic
959399805 3:105886178-105886200 TTTCTGAGGTTGGGGAAAGGTGG - Intergenic
959915152 3:111808387-111808409 TATGTCTGCTCGGAAAAAGGAGG + Intronic
960037203 3:113113893-113113915 TCTCTGAGTCTGGAAAAAGGAGG + Intergenic
960980408 3:123219150-123219172 TTTCTCAGTTTGGAAGTGGGAGG + Intronic
961369598 3:126421481-126421503 TTTATCGGCTTGGATAAGGGTGG + Intronic
963291772 3:143497521-143497543 TTTCTCATCCTGTGAAAAGGTGG - Intronic
964080915 3:152755741-152755763 TTTCTTAGCAAGGAAAAAGGAGG - Intergenic
964282057 3:155078512-155078534 TTTCTCTGCTATGAAAAAGATGG + Intronic
964945777 3:162221939-162221961 TTTTTAAGCTTGGAAAAATTTGG + Intergenic
966177727 3:177157322-177157344 TTTCTTGGCTTGGAAGATGGAGG - Intronic
966294927 3:178408516-178408538 TTTCTCACCTAGGAAAAGGGCGG - Intergenic
967782667 3:193457001-193457023 TGTCTCAGGTTGGCAAAAGCTGG + Exonic
969513326 4:7632054-7632076 TTTCTCAGGTGGGAAAAGTGAGG - Intronic
970285508 4:14508924-14508946 ATTCTAAGCTTTGAAAAAAGTGG + Intergenic
970603670 4:17659888-17659910 TTTCCAAGTTTGTAAAAAGGAGG + Intronic
971203821 4:24541685-24541707 TGTATCAGCCTGGAATAAGGGGG + Intronic
971422614 4:26488025-26488047 TTCCTCAACTGGGAAAAATGAGG + Intronic
972698047 4:41467105-41467127 TTACTCAGCTTTTAAAAAGAAGG - Intronic
974145825 4:57946086-57946108 TTTTGCAGCTTGGAGCAAGGTGG + Intergenic
974344985 4:60668135-60668157 ACTCTCAGATTTGAAAAAGGAGG + Intergenic
975189570 4:71444008-71444030 TTTATCAGCTTTGGAAAATGTGG - Intronic
977142511 4:93391399-93391421 TTTCTCAGCTGAGAAAAAGAGGG - Intronic
977833946 4:101626593-101626615 TTTTTGAGCTTATAAAAAGGTGG - Intronic
981440669 4:144778263-144778285 TATCTCAGGCTGGAAAATGGTGG + Intergenic
981912655 4:149999646-149999668 TTTCTCTGCCTGGCAGAAGGTGG + Intergenic
982367149 4:154591695-154591717 TTACTCAGCCTTGAAAAAGAAGG + Intergenic
982534489 4:156592690-156592712 TTACTCAGCCTTGTAAAAGGGGG - Intergenic
983294954 4:165855220-165855242 TTAATCAGCTTGGAAAAAAATGG - Intergenic
983674744 4:170279614-170279636 TGACTCACCTTGGAAAAAGGAGG + Intergenic
984847378 4:184119599-184119621 TTTTTCAGATGGGAAAACGGAGG - Intronic
986221453 5:5772354-5772376 TTTCTCAGCTTCAAAGAAAGAGG - Intergenic
987562759 5:19545518-19545540 TTTGTCAACTTGGACAAAGATGG + Intronic
988117781 5:26919664-26919686 TTCCTCTGCTTGAAAATAGGAGG + Intronic
988685988 5:33526176-33526198 CTTCTCAGGTTGGAAAATGGAGG - Exonic
988868169 5:35358311-35358333 TGCCTCAGCTTGGAGAAAGAAGG + Intergenic
989686192 5:44090029-44090051 TTTCCCTGCTTGGAGAAATGAGG + Intergenic
990096327 5:52118659-52118681 TTTTTCAGCTTTTAAAAAGAAGG - Intergenic
990298104 5:54423675-54423697 TTTCTCAAATTCAAAAAAGGAGG + Intergenic
992993642 5:82311310-82311332 TTTTTCATTTTGGAAAAAAGTGG - Intronic
993059762 5:83025128-83025150 TTTCTCATATTTAAAAAAGGAGG - Intergenic
993561842 5:89419163-89419185 TTTCTGAGCTTAAAAAAAGAGGG - Intergenic
993604317 5:89969400-89969422 TTTCTCAGATCGGAATAATGGGG + Intergenic
993804201 5:92384152-92384174 TGTCACAACTTGGAAGAAGGTGG + Intergenic
994933176 5:106216497-106216519 TATGACAACTTGGAAAAAGGGGG + Intergenic
997196572 5:131984391-131984413 ATCCTCAGTTTGGAAAAAGAAGG + Intronic
998027109 5:138827449-138827471 TTTCTCACCTTGAATAAAGAAGG + Intronic
998468902 5:142367746-142367768 GTTCTCTGCTTGGCTAAAGGTGG + Intergenic
998888071 5:146715621-146715643 TTTTTCAGTTGGGAAAATGGTGG + Intronic
999605217 5:153306581-153306603 TTTTTCAGCTTAGAAAACAGAGG - Intergenic
999664862 5:153902016-153902038 TTTCCCATCTGGGAAAAAAGAGG + Intergenic
1000674012 5:164098349-164098371 TTTATCACTTTGGAAAAAGCTGG - Intergenic
1001139403 5:169131648-169131670 TTTTTCAGCTTGGAAAAGGAAGG + Intronic
1002572059 5:180145650-180145672 TTTCTTTGCTTGAAAAAAGTGGG - Intronic
1002806844 6:585253-585275 TTTCTAAGGGTGGAAAAAGATGG - Intronic
1003213304 6:4087327-4087349 TTTCTCTGCTTTGAAAATGCAGG + Exonic
1003682594 6:8270828-8270850 TCCCTCAGCTGGGAAAAAAGAGG - Intergenic
1003774476 6:9344728-9344750 TTTCTGAGAGTGGAAAAAGCGGG - Intergenic
1005420347 6:25641988-25642010 TTTCTCAATTGGGGAAAAGGGGG + Intergenic
1006022291 6:31124417-31124439 TTTCTCATCTGTGAAACAGGGGG - Intronic
1006664747 6:35684476-35684498 TTTTTCTTCTTAGAAAAAGGTGG - Intronic
1007776453 6:44226963-44226985 TTTATAAGCTGGGAAACAGGAGG - Intronic
1008363976 6:50654236-50654258 TTTCTCAGCTGGGACACAAGGGG - Intergenic
1009551726 6:65104524-65104546 TTTCTCATCATGGAAAAAATTGG + Intronic
1009650074 6:66464421-66464443 CTTCTCAGTATGGAAAAAGTAGG + Intergenic
1010339285 6:74729224-74729246 TTTCTATGCTTAGAAAAATGGGG - Intergenic
1010486936 6:76425973-76425995 TTTCTCAGAGTGGCAAAATGGGG + Intergenic
1010751476 6:79620603-79620625 TTTCCCAGCCTGAAAAAAAGGGG + Intergenic
1011526126 6:88266883-88266905 TTTCTCAGCTGAGAAAAAGGAGG - Intergenic
1011781441 6:90794353-90794375 TCTGTCAGCTTGGAAAAGGAAGG - Intergenic
1012046707 6:94284944-94284966 TTACTCAGTTTGGAAAAAGAAGG - Intergenic
1012700904 6:102456032-102456054 TTTTTCAGCTTTGTAAAAGCAGG - Intergenic
1015403248 6:132810618-132810640 TTTCTGAGCTAGTAAAATGGTGG - Intergenic
1015461507 6:133496805-133496827 TTTCTCATTTTGGAGAAAGAAGG - Intronic
1016038921 6:139411753-139411775 TTTCTCTGCTTTCAAAAAGCAGG + Intergenic
1016903910 6:149130544-149130566 TTTATCCACTTGGAAAAAAGGGG - Intergenic
1017631945 6:156404562-156404584 TTTCCCCTCTTTGAAAAAGGTGG + Intergenic
1017709630 6:157155809-157155831 TTCCTCTGCTTGGAAGAAGCTGG + Intronic
1017990250 6:159481324-159481346 TTTCTCATCTTGGTAAAGAGTGG + Intergenic
1018223446 6:161605184-161605206 ATTCTCAGCTTTGAAAGGGGTGG - Intronic
1019998298 7:4739510-4739532 ATGCTCAGCTTTGTAAAAGGTGG + Intronic
1020224120 7:6266332-6266354 ATTTTCAGATTGGAAAATGGAGG - Intronic
1020393921 7:7691804-7691826 TTTCTCAGGAGGGAAAAAGGTGG + Intronic
1021146347 7:17093810-17093832 TTTCTCAGCTTGGGGAGAAGGGG - Intergenic
1021527262 7:21602425-21602447 TTCCACAGCATGGAAACAGGTGG - Intronic
1022444661 7:30460343-30460365 TTTCTTTGCTTGGTAAAGGGTGG + Intronic
1022608872 7:31848178-31848200 TTTCTAAACATGGAAAAAAGTGG - Intronic
1023008506 7:35902618-35902640 TTTCTAAACTTGGAATTAGGAGG + Intronic
1024043323 7:45571562-45571584 TTTCCCAGGTTGGAAGAAGAAGG - Intergenic
1024481208 7:49865354-49865376 TTTTTCAGCTGGGAAAACTGAGG - Intronic
1025527339 7:61831756-61831778 CTTCTCAGATTCTAAAAAGGAGG + Intergenic
1025613747 7:63100442-63100464 TTTCTCACAATGGAAAAAGCAGG + Intergenic
1025757480 7:64358348-64358370 TGTCCCACCTTGGAAAATGGTGG + Intergenic
1028958037 7:96715584-96715606 TTTCAAAGATTGGAAAAATGAGG - Intergenic
1030515682 7:110534727-110534749 CTTGTCAGCCTGGAACAAGGAGG + Intergenic
1030528568 7:110682998-110683020 TTGCTCTGCTTATAAAAAGGGGG + Intronic
1031026048 7:116681008-116681030 TTTCCCACCTTGGGAAATGGTGG + Intronic
1031887677 7:127257975-127257997 TTCCTCAGCTTGGAAATTCGAGG - Intergenic
1032156315 7:129471690-129471712 TTTCTCATCTTTGAAATAAGGGG - Intronic
1033043137 7:137936874-137936896 TTTTTCAACTTGGGAAAAGGAGG + Intronic
1034860382 7:154590085-154590107 TTTCCCAACTGGGAAACAGGTGG - Intronic
1036275033 8:7343352-7343374 TTTCTCAGCAGTGAAAATGGTGG + Intergenic
1036346321 8:7966996-7967018 TTTCTCAGCAGTGAAAATGGTGG - Intergenic
1036442703 8:8795610-8795632 TTTCCCAGTTTGGAGAAACGGGG + Intronic
1036670469 8:10781998-10782020 TTACTCAGCCTTTAAAAAGGAGG + Intronic
1036841643 8:12127754-12127776 TTTCTCAGCAGTGAAAATGGTGG - Intergenic
1037201037 8:16252221-16252243 TTTATTAGCTTGGACAAAAGTGG - Intronic
1037250474 8:16887388-16887410 TTTCTCACCTGGGAAATACGTGG + Intergenic
1038645598 8:29359099-29359121 TTTCTCTGCTTGGATAAATGAGG - Intergenic
1038906157 8:31905292-31905314 TTTCTCAGGTGGCAATAAGGGGG + Intronic
1038948049 8:32383485-32383507 GTTCACAGGTGGGAAAAAGGAGG - Intronic
1039200270 8:35083498-35083520 TTTCTATGCTTAGAAAAAGAGGG + Intergenic
1039589554 8:38735212-38735234 TTTCACAGCTTTGGAAAATGAGG + Intronic
1039656298 8:39411779-39411801 TTTTTCTGCTTGGGAGAAGGAGG + Intergenic
1041195097 8:55393829-55393851 TTTATTTACTTGGAAAAAGGAGG - Intronic
1042580712 8:70276290-70276312 TTTCTCATCTTGGAATCTGGAGG - Intronic
1042765037 8:72312177-72312199 TTTCTCAGCTCTGACAGAGGAGG - Intergenic
1043108012 8:76139844-76139866 TTTCTCTGCTTGCAAAATGATGG - Intergenic
1043814442 8:84784760-84784782 TGTCTAAACATGGAAAAAGGAGG - Intronic
1044461682 8:92452580-92452602 TTTTTCACCATGGAAAAAGTGGG + Intergenic
1044609504 8:94078175-94078197 TTTTTCTGCTTGGAAAATAGGGG - Intergenic
1046264018 8:111807360-111807382 TTTCTCTGCTTAGAAGAAAGGGG + Intergenic
1046700203 8:117392096-117392118 GTGTTCAGCCTGGAAAAAGGTGG + Intergenic
1047026344 8:120828672-120828694 TTTTTCAGATTGGAAAACTGAGG + Intergenic
1047207795 8:122817511-122817533 CTCCTCAGCATGGGAAAAGGGGG + Intronic
1047758455 8:127936463-127936485 TTTCTCAGAAAGGAGAAAGGTGG + Intergenic
1048021810 8:130546490-130546512 TGTCTTTGCTTGGAAAATGGAGG + Intergenic
1048604368 8:135952232-135952254 TTTTTCAGATGGGAAAATGGGGG + Intergenic
1048739511 8:137539022-137539044 TTTCTCTGCTCTGAAATAGGTGG + Intergenic
1048779685 8:137987535-137987557 ATTCTCAGCTTGGAGAAAAGGGG + Intergenic
1050729541 9:8692487-8692509 ATTCTCAGCTAGGAAAGATGAGG - Intronic
1051127954 9:13825662-13825684 TTTTTCAGATTAGCAAAAGGAGG - Intergenic
1051747301 9:20307241-20307263 TTTCTCTGCTTTTAAAAAAGGGG + Intergenic
1051982773 9:23044792-23044814 TTACTCAGCCTTAAAAAAGGAGG - Intergenic
1052201267 9:25784104-25784126 TTTCACAGATTAAAAAAAGGAGG - Intergenic
1052866034 9:33465174-33465196 CTTCTCAGCTGGGGAAAAAGTGG + Intronic
1054929347 9:70619808-70619830 TCTTTCAGCTAGGAAAAATGGGG - Intronic
1055734295 9:79311345-79311367 TTTCTCAGCTGTCAAAAATGGGG - Intergenic
1055839059 9:80480843-80480865 TTACTCAGCATGAAAAAAGATGG - Intergenic
1056267887 9:84917662-84917684 TTACTCTGCTTGGACAAAGTAGG - Intronic
1057692434 9:97296899-97296921 TTTCTCAGTTTCTAAAAAGCAGG - Intergenic
1058713040 9:107697577-107697599 TTTCTCAACTTGAAAACATGGGG + Intergenic
1059536175 9:115083140-115083162 TTTCTTCACTTGGAAAAAGAAGG + Intronic
1059686684 9:116644471-116644493 TTTCTCATCTGGGAAATGGGTGG - Intronic
1060659847 9:125398731-125398753 TTTCTCAGTTGGGAGAAAAGAGG - Intergenic
1061689372 9:132313354-132313376 GTTCCCATCTTGGAAAAAGGAGG + Intronic
1187764559 X:22626244-22626266 TTTGTCAGTTTTGAAAAGGGAGG - Intergenic
1190723736 X:53172454-53172476 TTTCTCAGGTTGTGAGAAGGAGG - Intergenic
1191666594 X:63708850-63708872 TTTCTTAGCCTAGAAAAAGGTGG + Intronic
1191670918 X:63747831-63747853 TTTCTCCTCTTTGAAAAAGCAGG - Intronic
1191790108 X:64961358-64961380 TTTCTTAGTTTAGAAAAAGAGGG - Intronic
1192226074 X:69228924-69228946 TTTCTCTAGCTGGAAAAAGGAGG + Intergenic
1193882311 X:86937709-86937731 TTTCTCACCTGGGAAATATGGGG + Intergenic
1194204940 X:91001834-91001856 TTACTCAGCTTGGAAAAGAAAGG + Intergenic
1196203122 X:112908815-112908837 TTTCTCTGACTTGAAAAAGGAGG + Intergenic
1196264159 X:113622085-113622107 TTATTCAGCCTTGAAAAAGGAGG + Intergenic
1197176534 X:123492193-123492215 TTTTTCTCCTTGGAAGAAGGAGG + Intergenic
1197605992 X:128586115-128586137 TTTTTCAGCTCGGAAATAGCAGG - Intergenic
1198675378 X:139125350-139125372 TTTCTCAGCTTGCAAAATTATGG + Intronic
1199582459 X:149373827-149373849 GTTCTGATCTTGGAAAAAGAAGG - Intergenic
1199843630 X:151675194-151675216 TTGCTCAGCTGGGAGAAAGCAGG + Intronic
1199974489 X:152884966-152884988 CTGCTCAGCTTGGGAAAAAGGGG - Intergenic
1199998706 X:153044876-153044898 TTTGTGAGCTAGGCAAAAGGGGG + Intergenic
1200550766 Y:4576977-4576999 TTACTCAGCTTGGAAAAGAAAGG + Intergenic
1201055253 Y:9982545-9982567 TTTTTCAGCTTGTAAAAAACAGG - Intergenic
1201252969 Y:12079254-12079276 TTTCTCAGTATATAAAAAGGAGG + Intergenic
1201503954 Y:14677337-14677359 TTTCTCAGGTGGTAAAAAGGGGG - Intronic