ID: 936399820

View in Genome Browser
Species Human (GRCh38)
Location 2:112156581-112156603
Sequence GCACGGTGCTGGGCAGGTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 256}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936399820 Original CRISPR GCACGGTGCTGGGCAGGTAC GGG Intronic
900959462 1:5909883-5909905 AGGCGGGGCTGGGCAGGTACAGG - Intronic
902601219 1:17540917-17540939 GCACAGTGCTGGGCGGATGCTGG - Intronic
902626258 1:17678101-17678123 CCAGGGTGGTGGGCAGGCACAGG + Intronic
903068778 1:20716387-20716409 GCAGGGAGCTGGACACGTACAGG + Intronic
903269358 1:22178026-22178048 GCAGGGTCCTGGGCAGGCAGGGG - Intergenic
903766192 1:25736201-25736223 GGACAGAGCTGGGCAGGGACTGG - Intronic
905395840 1:37665832-37665854 GCTCGGTGCTGGGCATTCACTGG + Intergenic
907242968 1:53090822-53090844 GGAGGGTGCTGGGCAGACACCGG - Intronic
907340763 1:53734597-53734619 GTAAAGTGCTGGGCAGATACTGG - Intergenic
914025145 1:143905825-143905847 CCACGGTGCCGGGCCGGTAGCGG + Exonic
914663582 1:149813540-149813562 CCACGGTGCCGGGCCGGTAGCGG + Exonic
915164352 1:153940380-153940402 GCAGGGTGGTGGGCAGGAATGGG - Intronic
917607811 1:176652831-176652853 ACATGGTGCTGGGCAGGTTGTGG + Intronic
919115454 1:193275775-193275797 ACCCGGTTCTGGGCTGGTACTGG + Intergenic
919656362 1:200200998-200201020 GCATGCAGATGGGCAGGTACAGG - Intergenic
920089236 1:203440647-203440669 GCACAGTGCTGGGCACGTGGGGG + Intergenic
921220604 1:212970974-212970996 GAACGGTGGTGGGCAGGGGCTGG - Intronic
923146909 1:231204424-231204446 GCAAGGTGCTGGGCATATAGAGG + Intronic
1064018997 10:11794328-11794350 GCCCAGTGCTGGGAAGGGACAGG - Intergenic
1064785328 10:18888299-18888321 GCACGCAGGTGAGCAGGTACAGG - Intergenic
1065753059 10:28906087-28906109 GCTCTGTGCTGGGCAGGAAGCGG + Intergenic
1065811592 10:29448361-29448383 GCCCCGTGCTGGGGAGGTCCTGG + Intergenic
1066732505 10:38448704-38448726 GCTGGGAGCTGGGCAGGAACTGG - Intergenic
1067052080 10:43027580-43027602 CCACAGGGCTGGGGAGGTACTGG - Intergenic
1067346409 10:45441804-45441826 GCAGAGTGCTGGGGAGGTCCAGG - Intronic
1067414312 10:46092027-46092049 GCACTGAGCTGTGCAGGGACTGG - Intergenic
1067434374 10:46266572-46266594 GCACTGGGCTGTGCAGGGACTGG - Intergenic
1067439321 10:46299785-46299807 GCACTGGGCTGTGCAGGGACTGG + Intronic
1067576065 10:47409425-47409447 GCACTGGGCTGTGCAGGGACTGG + Intergenic
1069038870 10:63673413-63673435 GCACGCATATGGGCAGGTACGGG - Intergenic
1069660914 10:70122971-70122993 GCCTGGTGCTGGGCAGATAGCGG - Intronic
1070646114 10:78203549-78203571 GGCAGGTGCTGGACAGGTACTGG - Intergenic
1071786118 10:88902195-88902217 GCACAGTGCTGGGCAGTGAGGGG - Intronic
1074480781 10:113818389-113818411 GCACTGTGCTAGGCAGGCCCAGG + Intergenic
1075572453 10:123556155-123556177 GCACTGCACTGGGCAGGTGCTGG - Intergenic
1075785724 10:125048754-125048776 GGACGGTGCTGGGGAGGGGCCGG + Intronic
1076040093 10:127239054-127239076 ACACCCTGCTGGACAGGTACAGG + Intronic
1076166608 10:128287046-128287068 GCGCTGTGCTGGGCAGGTGGCGG + Intergenic
1076354016 10:129839458-129839480 GCCAGGCGCTGGGCAGGCACAGG + Intronic
1076721136 10:132393897-132393919 GGACAGTGCTGGGCAGGTCCAGG + Intergenic
1076809247 10:132878254-132878276 GCACGGAGCTGGGCTGGCCCGGG + Intronic
1076890488 10:133280884-133280906 GGGCGGTGCTGGGCAGGGGCAGG + Intronic
1076890524 10:133281008-133281030 GGGCGGTGCTGGGCAGGGGCAGG + Intronic
1076890581 10:133281202-133281224 GGGCGGTGCTGGGCAGGGGCAGG + Intronic
1077200499 11:1304707-1304729 ACACTGTGCTGGGAAAGTACAGG - Intronic
1077220386 11:1413077-1413099 GGATGGGGCTGGGCAGGGACTGG + Intronic
1077252886 11:1568356-1568378 GCAGGGTGGTGGGCAGGGGCTGG + Intronic
1077643940 11:3906758-3906780 GCACAGTGCTAGGCATGTAATGG + Intronic
1077906488 11:6538680-6538702 GCACGGGGCTGTGCAGCTCCAGG - Exonic
1078675354 11:13407492-13407514 GCACAGTGCTGGGCATATAATGG + Intronic
1079402048 11:20113719-20113741 CCACTGTGCTGGGCTGGTCCTGG - Intronic
1080549356 11:33358296-33358318 GCACTGTGCTGGGTAGTTACTGG - Intergenic
1083640056 11:64140518-64140540 GCTGGGTGCAGGGCAGGTGCTGG + Intronic
1083767272 11:64847567-64847589 GCACGGGGCAGGGCTGGGACTGG + Intergenic
1083927763 11:65818885-65818907 GCACTGTGCTAGGCAGATTCTGG - Intergenic
1084334453 11:68448578-68448600 GCAGGCTGCAGGGCAGGTGCGGG + Intronic
1085318690 11:75561683-75561705 TCCGGGTGCCGGGCAGGTACCGG + Intergenic
1087127760 11:94643421-94643443 GCAAATTGCTGGGCAGGTAGGGG - Intergenic
1087401541 11:97672912-97672934 GTAGGGTGCTGGGGAAGTACTGG - Intergenic
1089363784 11:117908811-117908833 GAACGCTGCCAGGCAGGTACTGG - Intronic
1091004278 11:131938477-131938499 TCACGGAGGTGGGCAGGGACCGG + Intronic
1096216121 12:49798349-49798371 GCACTGTGCTGGGCAGAGAGAGG - Exonic
1096224294 12:49855204-49855226 GCACGATGCCGGGCAGCTAAAGG + Intergenic
1097990141 12:65825198-65825220 GAAAGGTGCTGGGCAGCTCCGGG + Exonic
1104068942 12:125328258-125328280 GCACCGTGCTGGGCTGGAAAGGG - Intronic
1104926843 12:132318303-132318325 GCATGGGGCTGGGCGGGCACTGG + Intronic
1105213540 13:18271740-18271762 GCACGGAGCAGGGCAGGTAGGGG + Intergenic
1105984566 13:25552849-25552871 ACAAGGAGCTGGGAAGGTACAGG - Intronic
1106815557 13:33403153-33403175 ACACGCAGATGGGCAGGTACAGG - Intergenic
1108799869 13:54082007-54082029 GCACGCAGATGGGCAGGTATAGG - Intergenic
1110603078 13:77399003-77399025 GCACAGTGCTTGGATGGTACAGG - Intergenic
1113288382 13:108878770-108878792 GCATGCAGATGGGCAGGTACAGG - Intronic
1113781241 13:112978886-112978908 GCACCGTGCTGGGCACACACAGG - Intronic
1113925959 13:113941791-113941813 CCAGGGCGCTGGGCAGGTCCAGG - Intergenic
1113929796 13:113962042-113962064 GTATTGTGTTGGGCAGGTACAGG + Intergenic
1115520807 14:34231363-34231385 GCACAGTGCTGGGCACATAATGG + Intronic
1117865394 14:60143081-60143103 GCACAATGCTAGGCAGGCACTGG + Exonic
1121048129 14:90802737-90802759 GGACGCTGCTGCGCAGGTGCAGG + Intronic
1122040346 14:98983461-98983483 GCAGGGTCCTGGGCCGGTCCTGG + Intergenic
1122199782 14:100115378-100115400 GCCTGGTGCTGCGCATGTACCGG - Intronic
1122215619 14:100202001-100202023 GCACTGTGCTGGGCAGGTTCCGG - Intergenic
1122229563 14:100298935-100298957 GCAGGGTGCTGGGCAGGAGGGGG + Intronic
1122271551 14:100570580-100570602 GCCAGGTGCTGGGCTGGTCCAGG - Intronic
1122574378 14:102732456-102732478 GCACGGTGCTTGGGAGCTGCAGG - Intergenic
1122863016 14:104591075-104591097 GCAGTGTGCTGGGCAGGGGCTGG - Intronic
1122881480 14:104692391-104692413 GCACGGTGCCAGGCAGGTGCAGG + Intronic
1124667973 15:31609914-31609936 GCCCGGCTCTGGGCTGGTACTGG - Intronic
1126782534 15:52150812-52150834 GCAGGTTGCTGGGCAGGCAGTGG + Intronic
1128802145 15:70503754-70503776 GCTCTGTGCTGGGCAGAGACTGG - Intergenic
1131352394 15:91713166-91713188 GCACGGTGCTGGGCACCTGATGG + Intergenic
1132235228 15:100215103-100215125 GCACTGTGCCTGGCAGGTTCCGG + Intronic
1132484178 16:181593-181615 GCTGGGTGCTGCGCAGGTACCGG - Intergenic
1133420967 16:5646604-5646626 GCAGGGGTCTGGGCAGGTAAGGG + Intergenic
1134138487 16:11696494-11696516 GCACTGTGCTGGGAAGCTCCAGG - Intronic
1135327946 16:21539337-21539359 CCACAGTGCTGGCCAGGGACAGG - Intergenic
1136293346 16:29288713-29288735 GCTTGGTGCTGGGCAGGGCCAGG + Intergenic
1136338297 16:29625361-29625383 CCACAGTGCTGGCCAGGGACAGG - Intergenic
1139402886 16:66696429-66696451 GCTCGGTGGTGGGCTGGTACGGG + Exonic
1141966934 16:87451986-87452008 GCACGGGGCTGGGCAAGTGTGGG + Intronic
1142191473 16:88720151-88720173 GCACGGTCTTGCGCAGGTAGAGG + Exonic
1142223054 16:88864721-88864743 GCACGGTGCTTGGCTGGGCCTGG - Intronic
1142599297 17:1045676-1045698 GCACCGTGCTGGGCTCGTCCTGG + Intronic
1143031464 17:3970225-3970247 GCACGGTGGTGCGCACCTACAGG - Intergenic
1147420745 17:40321102-40321124 GCACGGTGGGGGGCAGGGCCTGG + Intronic
1147890705 17:43714603-43714625 GCACGGTGCTAGGAAGGAAAAGG - Intergenic
1147892108 17:43724742-43724764 GGAAGGTGCTGGGCAGGGCCTGG - Intergenic
1147894546 17:43742025-43742047 GCATGGTGCTGGGCATCTGCTGG + Intergenic
1148686978 17:49506576-49506598 ACACGGTGCAGGGCAGGCACGGG - Exonic
1148818070 17:50345249-50345271 GCACAGTGCTGGGGACGCACAGG + Intergenic
1149141409 17:53436977-53436999 GCACTGGGCTGGGCAGGAACTGG - Intergenic
1149659000 17:58324728-58324750 GCACGGTGCAGGGGAGATCCCGG + Intronic
1151842884 17:76630189-76630211 GCAGTGTGCTGTGCAGGCACTGG + Intronic
1151946760 17:77323842-77323864 CCACGGGGCTGGGCAGGAAGCGG - Intronic
1151965599 17:77429655-77429677 GGAGGGTGCTGGGCAGGAGCTGG + Intronic
1151967278 17:77437931-77437953 GCACAGTGCAGGGCAGGGCCAGG - Intronic
1152604499 17:81282366-81282388 GCCCGGTGGTGAGCAGGCACGGG - Intronic
1152615366 17:81335397-81335419 GCACTATGCTGGGCAGGAGCAGG + Intergenic
1152785308 17:82244900-82244922 TGACGGTGCTGGGCAGGGAGGGG + Intronic
1157810575 18:50692611-50692633 GCATAGTGCTGGGCAGGGAGAGG + Intronic
1158872287 18:61699588-61699610 GCTGGGGGCTGGGCAGGTGCTGG + Intergenic
1160060624 18:75526042-75526064 GCACTGTGCTGGGGAGGTCCTGG + Intergenic
1160430722 18:78810810-78810832 CCAAGGTGCTGTCCAGGTACAGG - Intergenic
1161009748 19:1954512-1954534 TCACTGGGCTGGGCAGGTGCAGG - Intronic
1161033272 19:2069851-2069873 CCACGGCGCTGGGAAGGGACAGG - Intergenic
1161035138 19:2080204-2080226 GCAGGGTGCTGGGCAGGGCGGGG + Intronic
1161162336 19:2768305-2768327 ACACAGTGCTGGGCAGGAAGTGG - Intronic
1162513046 19:11131332-11131354 GAAGGGTTCTGGGCAGGGACGGG - Exonic
1162557690 19:11397564-11397586 GCCGGGGGCTGGGCAGGTCCAGG + Exonic
1163735550 19:18978168-18978190 TCACGGTCCTGGGCAGGGCCAGG + Intergenic
1165144112 19:33720713-33720735 GCAGGGAGCTGGGCAGGCAGTGG + Intronic
1165248849 19:34513947-34513969 GCAGGGCCCTGGGCAGGTCCAGG + Intergenic
1167590537 19:50402236-50402258 CCACGGTGATGCGCAGGAACGGG - Exonic
1167831772 19:52028762-52028784 TCACGGTGCTGGCCAGGAAGCGG + Intronic
925135261 2:1522237-1522259 GCACGGTGGCGGGCAGGTGTGGG - Intronic
927591281 2:24360254-24360276 GCAAGGCGCGGGGCAGGTGCGGG - Intronic
928770113 2:34695618-34695640 GGACATTGCTGGGCAGGTGCAGG - Intergenic
929714982 2:44301106-44301128 GCACGGAGCCCGGCAGATACAGG + Exonic
931070116 2:58637440-58637462 GCACAGTGCTGGGCACTTAGGGG + Intergenic
934300788 2:91775006-91775028 GCATGGAGCAGGGCAGGTAGGGG - Intergenic
936399820 2:112156581-112156603 GCACGGTGCTGGGCAGGTACGGG + Intronic
937915638 2:127097481-127097503 GCATGGGACAGGGCAGGTACAGG + Intronic
941002961 2:160220813-160220835 GCACATTGCTGGGCTTGTACAGG - Intronic
942552020 2:177129640-177129662 TCATGTTGCTGGGCAGGAACAGG - Intergenic
946817583 2:223594596-223594618 GGAGGGTTCTGGGCAGGGACAGG + Intergenic
947871475 2:233441196-233441218 GGACGCTGCTGGGCAGGGGCAGG + Intronic
948318788 2:237052539-237052561 TCTCAGTGCTGGGCATGTACAGG + Intergenic
948370924 2:237488523-237488545 GCACGGTCCTGGGCAGGGAGGGG - Intronic
948604485 2:239126284-239126306 GCACAGAGCTGGGCAGGGGCAGG - Intronic
1171250514 20:23642637-23642659 GCAGGATCCTGGGCAGGAACAGG - Intergenic
1172110263 20:32540520-32540542 GGTCGGTGCTGGGCAGGTGTGGG - Intronic
1172511490 20:35504093-35504115 GCAGTGTGCTGAGCAGGCACAGG + Exonic
1172528663 20:35616359-35616381 GGGCGGTGCTGGGCGGGGACGGG + Intronic
1173732799 20:45340244-45340266 GCATGGTGCTTGGCATGTAGTGG - Intronic
1174050617 20:47764965-47764987 GCACGACACTGGGCAGGTTCTGG - Intronic
1175311178 20:58012517-58012539 GCAAGGTGCTGGGCAGGGGGTGG - Intergenic
1175400600 20:58698004-58698026 GCACGGTTCTGGGCACGGAGGGG - Intronic
1175496019 20:59414824-59414846 GAATGGTGCTGGGGAGGTTCTGG - Intergenic
1175794832 20:61765127-61765149 GCCCAGTGCTGAGCAGGGACAGG - Intronic
1175826055 20:61937124-61937146 GCGCGGTGCTGGGCAGCGGCCGG - Exonic
1179663529 21:42893448-42893470 GCGCGGTGCTGGTCAGGTCCGGG + Intronic
1179839567 21:44062571-44062593 GTACAGGGCTGGGCTGGTACAGG + Intronic
1180137026 21:45868585-45868607 GCAGGGAGCTGGGCAGGCATGGG - Intronic
1180816371 22:18792131-18792153 GCACGGAGCAGGGCAGGTAGGGG + Intergenic
1181041127 22:20193129-20193151 GCCCAGTGCTGGGCAGGCAGTGG - Intergenic
1181202560 22:21226463-21226485 GCACGGAGCAGGGCAGGTAGGGG + Intronic
1181531263 22:23518850-23518872 CCACCGTGCTGGGCAGTGACAGG + Intergenic
1181699145 22:24610142-24610164 GCACGGAGCAGGGCAGGTAGGGG - Intronic
1182150326 22:28023011-28023033 CCACAAGGCTGGGCAGGTACAGG + Intronic
1182393796 22:30020833-30020855 GTAGGGAGCTGGTCAGGTACTGG - Exonic
1183495147 22:38139080-38139102 GCACGTTGGGAGGCAGGTACAGG - Intronic
1183783035 22:40010906-40010928 GCACAGTTCAGGGCAGGTATGGG - Intronic
1184608678 22:45588904-45588926 TCCCGGTGCTGGCCAGGTAATGG - Intronic
1184973330 22:48043310-48043332 GCCCAGGGCTGGGCAGGTAGGGG + Intergenic
1185053875 22:48567875-48567897 GCAAGGTGCTGGGCAGGCCTGGG + Intronic
1185058495 22:48593330-48593352 GCACGGGGCAGGGGAGGGACTGG + Intronic
1203224355 22_KI270731v1_random:68950-68972 GCACGGAGCAGGGCAGGTAGGGG - Intergenic
1203266471 22_KI270734v1_random:17842-17864 GCACGGAGCAGGGCAGGTAGGGG + Intergenic
949650398 3:6151602-6151624 GCACAGTGCTGGGCACATAGTGG + Intergenic
950497013 3:13339937-13339959 GAGCGCTGCTGGGCTGGTACAGG - Exonic
950549334 3:13656660-13656682 GAAAGGTGCTGGGCAGGTGGAGG + Intergenic
950578953 3:13850488-13850510 GCAAGAGGCTGGGCAGGGACTGG + Intronic
953185354 3:40632166-40632188 ACAGGGTTCTGGGCTGGTACTGG - Intergenic
953918876 3:46938213-46938235 CCACTGAGCTGGGCAGGTGCAGG - Intronic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
955387176 3:58489133-58489155 GCACGGTGCTGGGAGGGCAAAGG - Intergenic
955962968 3:64359887-64359909 GCCCGGTGCTGATGAGGTACAGG - Intronic
957016333 3:75069107-75069129 GCCCGGTTCTGAGCTGGTACTGG + Intergenic
958534924 3:95387926-95387948 GCACAGTGCTGGGAAGTTAATGG + Intergenic
959132548 3:102374985-102375007 CCACAGAGCTGGGCAGGCACAGG - Intronic
959334612 3:105048435-105048457 GCCCGGTTCAGGGCAAGTACTGG - Intergenic
960967443 3:123114989-123115011 GCTTGGTGCTGGGGAGGTTCTGG + Intronic
961000875 3:123373117-123373139 GCTAGGTGCTGTGGAGGTACTGG - Intronic
962204708 3:133425329-133425351 GCACTGTGCTGGGCACGTGATGG + Intronic
962273891 3:133997983-133998005 TCACGGTGCCGGGGAGGTGCTGG + Intronic
968524140 4:1047355-1047377 TCACGGTGGTGTGCAGGTGCAGG - Intergenic
968613770 4:1568410-1568432 CCACGGTGCAGGGCAAGCACAGG + Intergenic
968645824 4:1740060-1740082 GCAGGGTGCAGGGCAGGGCCAGG - Intronic
969258723 4:6020755-6020777 TCACGGTGCGGTGCAGGTACAGG - Intergenic
969311767 4:6357060-6357082 GCGAGGTGCTGGGCAGGGAAAGG + Intronic
969509824 4:7611440-7611462 GCACCGTGCTGGGCAGTCTCAGG - Intronic
969704659 4:8785261-8785283 GCAGGGTGCTGGACAGGGAGTGG - Intergenic
971299551 4:25430531-25430553 ACACGGTGCTCTGCAGGTCCTGG - Intergenic
971351507 4:25860325-25860347 GGATGGGGCTGGGCAGGTGCAGG - Intronic
979307642 4:119165840-119165862 GCAAGCTGCTCAGCAGGTACAGG - Intronic
981003990 4:139856135-139856157 GCATTGTGCTGGGTAGGAACAGG - Intronic
983141412 4:164154597-164154619 GCACGCAGATGGGCAGGTGCAGG + Intronic
985579828 5:690721-690743 GCACCGGGCTGGGCAGGGCCCGG - Intronic
985594674 5:782780-782802 GCACCGGGCTGGGCAGGGCCCGG - Intergenic
985788094 5:1910433-1910455 ACACCGGCCTGGGCAGGTACAGG - Intergenic
985946161 5:3185717-3185739 GCTTGGTGCTGGGCAGTCACGGG - Intergenic
989683318 5:44055198-44055220 GCAGGGGGCTGGACAGATACTGG + Intergenic
991964728 5:72079622-72079644 GGAAGCTGCTGGGAAGGTACTGG - Intergenic
993188150 5:84646246-84646268 GCACGCAGATGGGCAGGTCCTGG - Intergenic
993661366 5:90640513-90640535 GTACAGTGCTTGGCAGGCACAGG + Intronic
994329899 5:98492383-98492405 ACACAGTTCTGGGCTGGTACTGG - Intergenic
994731225 5:103493503-103493525 GAAAGGTGCTTGCCAGGTACAGG - Intergenic
997600214 5:135133960-135133982 GATCGGGGCTGGGCAGGGACAGG - Intronic
997841481 5:137244754-137244776 GCAAGGTGCTGGGCACCTGCTGG + Intronic
999351860 5:150879515-150879537 GCACTGTGCTGGCTAGGCACTGG + Intronic
999476784 5:151907602-151907624 GCACAGTGCTGGGCATATAGTGG - Intronic
1001917543 5:175574309-175574331 GCATAGTGCTTGGCATGTACTGG + Intergenic
1002167539 5:177357928-177357950 GCACGGTGGCGGGCAGGCAGTGG - Exonic
1002295864 5:178231094-178231116 GCACAGTGCTGGCCAAGTGCTGG - Intronic
1002534349 5:179867967-179867989 GCACTGTCATGGGCAGGTGCTGG - Intronic
1002868864 6:1147752-1147774 GCACCGTGGTGAGCAGGTCCTGG - Intergenic
1003482745 6:6547831-6547853 GCAGGGTGCTGGGCAAGTCAAGG - Intergenic
1003567131 6:7231005-7231027 GCCGGGTGCTGGGCAGGGAGAGG - Exonic
1007942071 6:45790692-45790714 GCACAGCCCTGGGCAGGAACAGG + Intergenic
1009437422 6:63634833-63634855 GTAAGGTGCTCAGCAGGTACTGG + Intergenic
1009610053 6:65930329-65930351 GCAGGCTGGTGGGCAGCTACAGG + Intergenic
1011150178 6:84263593-84263615 GCATGGTGCTGGGAAGGCTCTGG + Intergenic
1011491774 6:87900467-87900489 GCACGTAGATGGGCAGGTGCAGG + Intergenic
1018503821 6:164442579-164442601 GCAAGGTGCTGGTGAGGAACAGG + Intergenic
1019105451 6:169663794-169663816 GGAGGGTGCTGGGTAGGTGCAGG + Intronic
1019413417 7:916594-916616 GCTGGGTGCTGAGCAGGTCCAGG + Intronic
1019644397 7:2121329-2121351 CCACGGTGCCTGGCAGGTGCTGG - Intronic
1020007821 7:4791785-4791807 CCAGGGTGCAGGGCAGGTAACGG - Intronic
1020027182 7:4907416-4907438 GCAGGGTGCTGGGCAGATAGAGG + Exonic
1023368569 7:39489601-39489623 ACAATGTGCTGGGCAGGCACAGG - Intronic
1023773599 7:43583018-43583040 GCAGGGTGCAGGGCAGGCGCGGG + Intronic
1025638499 7:63346457-63346479 GGTTGGTGCTGGGAAGGTACTGG - Intergenic
1025644197 7:63401632-63401654 GGTTGGTGCTGGGAAGGTACTGG + Intergenic
1025713797 7:63934695-63934717 GGTTGGTGCTGGGAAGGTACTGG + Intergenic
1027108954 7:75422325-75422347 GCACGGCAGTGGGCAGGGACTGG + Exonic
1028982052 7:96978126-96978148 GCCCAGTGCTGGGCACATACAGG - Intergenic
1029695783 7:102212337-102212359 GCAGGGTGCTGGGGCGGTGCTGG - Intronic
1034732619 7:153400963-153400985 CCACGGAGCTGGGCAGGAGCGGG - Intergenic
1034874978 7:154717411-154717433 GAACGGTGCTGGGAAGGTGCTGG - Intronic
1035174440 7:157040247-157040269 GCGCGCTGCTGGGCCGGTCCGGG + Intergenic
1035388793 7:158491332-158491354 GCACTGGGCTGGGCAGGCACTGG - Intronic
1035748542 8:1978973-1978995 GCACAGCCCTGGGCAGGCACAGG + Intronic
1036184535 8:6612518-6612540 GCACTGAGCGGGGCAGGCACCGG - Intronic
1038423800 8:27451692-27451714 GCAGGGTGCTAGGCAGGGAGAGG - Intronic
1040495168 8:47959962-47959984 CCGCGGTGCTGGGTGGGTACCGG - Exonic
1041093540 8:54326941-54326963 GCAGGGAGCTGGGCAGGCTCAGG - Intergenic
1042348470 8:67751505-67751527 GCACGCGGATGGGCAGGTGCAGG + Intergenic
1042511765 8:69619785-69619807 GCACGCAGATAGGCAGGTACAGG + Intronic
1043702050 8:83301092-83301114 GCATGCAGATGGGCAGGTACCGG - Intergenic
1044792838 8:95865184-95865206 GCATCGTGCTGGGCAGGCAGTGG + Intergenic
1048993301 8:139774010-139774032 GCACGGTGCTGAGCTGGACCAGG + Intronic
1049243480 8:141550224-141550246 TCACCGTGCTTGGCAGATACAGG - Intergenic
1049672737 8:143877112-143877134 GCATGGTGCGGGGCATGCACTGG - Intronic
1052335257 9:27312643-27312665 GCACGGTGCTTGGCACAAACTGG + Intergenic
1053241558 9:36499738-36499760 GCCCTGTGCAGGGCTGGTACAGG - Intergenic
1053425337 9:38006402-38006424 GCAGGGAGCTGGGCGGGTACAGG + Intronic
1055486335 9:76759892-76759914 GCACGCAGATGGGCAGGTGCAGG - Intronic
1057076035 9:92138580-92138602 GCCCTGTGCTGGGAAGGTACAGG + Intergenic
1057119430 9:92558438-92558460 GCCCGGCTCTGGGCTGGTACTGG + Intronic
1057720337 9:97527314-97527336 GCACTGTGCTGGGCACCAACAGG + Intronic
1059452528 9:114379325-114379347 GCACAGGGCTGGGCAGGGTCTGG - Intronic
1060932520 9:127497840-127497862 GCACAGCGGTGGGCAGGTGCCGG - Intronic
1060968170 9:127723133-127723155 GCAAGGCGCTGTGCAGGTCCCGG - Exonic
1061251500 9:129428937-129428959 GCTGGGTGCTGGGCATGCACAGG + Intergenic
1061932938 9:133842687-133842709 GCCAGGTGCTGGCCTGGTACTGG + Intronic
1062008098 9:134251606-134251628 GCAGGCTGCTGGGTAGGTTCTGG + Intergenic
1062246751 9:135572539-135572561 GGATGGTGCTGTGCAGTTACAGG + Intergenic
1062423719 9:136496622-136496644 GCCGGGTGCTGGGCAGGCCCTGG + Exonic
1194752206 X:97697498-97697520 GCACACAGATGGGCAGGTACAGG - Intergenic
1196062963 X:111431046-111431068 GCTCAGTGCTGGTCAGGTGCAGG - Intergenic
1196856477 X:119990032-119990054 TCACTGTGCTGGGCAGGCGCTGG - Intergenic