ID: 936403649

View in Genome Browser
Species Human (GRCh38)
Location 2:112184252-112184274
Sequence TCTGACCCACCAAGGGAGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 153}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936403644_936403649 -1 Left 936403644 2:112184230-112184252 CCCGCTGGCTCCAGATAACAGCT 0: 1
1: 0
2: 2
3: 14
4: 149
Right 936403649 2:112184252-112184274 TCTGACCCACCAAGGGAGAACGG 0: 1
1: 0
2: 3
3: 17
4: 153
936403643_936403649 0 Left 936403643 2:112184229-112184251 CCCCGCTGGCTCCAGATAACAGC 0: 1
1: 0
2: 0
3: 12
4: 120
Right 936403649 2:112184252-112184274 TCTGACCCACCAAGGGAGAACGG 0: 1
1: 0
2: 3
3: 17
4: 153
936403635_936403649 29 Left 936403635 2:112184200-112184222 CCCCCATGGAAACAGGACACAGA 0: 1
1: 0
2: 1
3: 28
4: 266
Right 936403649 2:112184252-112184274 TCTGACCCACCAAGGGAGAACGG 0: 1
1: 0
2: 3
3: 17
4: 153
936403636_936403649 28 Left 936403636 2:112184201-112184223 CCCCATGGAAACAGGACACAGAG 0: 1
1: 0
2: 2
3: 30
4: 380
Right 936403649 2:112184252-112184274 TCTGACCCACCAAGGGAGAACGG 0: 1
1: 0
2: 3
3: 17
4: 153
936403639_936403649 26 Left 936403639 2:112184203-112184225 CCATGGAAACAGGACACAGAGGG 0: 1
1: 1
2: 6
3: 40
4: 367
Right 936403649 2:112184252-112184274 TCTGACCCACCAAGGGAGAACGG 0: 1
1: 0
2: 3
3: 17
4: 153
936403637_936403649 27 Left 936403637 2:112184202-112184224 CCCATGGAAACAGGACACAGAGG 0: 1
1: 0
2: 10
3: 197
4: 493
Right 936403649 2:112184252-112184274 TCTGACCCACCAAGGGAGAACGG 0: 1
1: 0
2: 3
3: 17
4: 153
936403645_936403649 -2 Left 936403645 2:112184231-112184253 CCGCTGGCTCCAGATAACAGCTC 0: 1
1: 0
2: 2
3: 12
4: 171
Right 936403649 2:112184252-112184274 TCTGACCCACCAAGGGAGAACGG 0: 1
1: 0
2: 3
3: 17
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936403649 Original CRISPR TCTGACCCACCAAGGGAGAA CGG Intronic
900537289 1:3185170-3185192 CCTGAGGCACCAAGGGAGATGGG - Intronic
903619225 1:24685861-24685883 TCGGACCCACCCAGGCAGTAGGG + Intergenic
903647516 1:24904161-24904183 TGTCACCCACCAAAGGATAAGGG + Intronic
904544870 1:31261501-31261523 TCTGTCCCAACGAGGGGGAAAGG - Intronic
911034525 1:93526686-93526708 TCTGCCACACCAAGGATGAAGGG + Intronic
914851334 1:151316405-151316427 TCTGGCCCACCAGGGAATAATGG - Exonic
915677855 1:157548189-157548211 TCTGACCCTCCCTGGGGGAAGGG - Intronic
918068479 1:181117985-181118007 TGTGGCCCACCTAGGGAGGAAGG - Intergenic
918615066 1:186534651-186534673 TCTGACCCAGAAAGAGAGAGAGG + Intergenic
918656846 1:187037374-187037396 TCTGATCCCCTGAGGGAGAAGGG + Intergenic
919865790 1:201782089-201782111 TCTTTCCCTCCATGGGAGAAGGG - Intronic
920715203 1:208333982-208334004 TCTCACCTAACAAGGTAGAAAGG - Intergenic
921599465 1:217090732-217090754 TCTGGCCCACCAGGGGAGTCTGG + Intronic
1064007852 10:11712647-11712669 TCTGACACCCCAAGAAAGAAAGG + Intergenic
1065945665 10:30603842-30603864 TCTCAGCCATCAAGGGGGAAAGG + Intergenic
1072155171 10:92717178-92717200 GCTGTACCACCAAGGGGGAAGGG + Intergenic
1073512542 10:104051782-104051804 TCTGGGCAACCCAGGGAGAATGG - Intronic
1075685631 10:124363485-124363507 TCTGACGGAACAAGGAAGAAAGG + Intergenic
1078577193 11:12512481-12512503 TCTGACTCAGGAAAGGAGAAGGG - Intronic
1081710873 11:45214499-45214521 TTTGTCCCACGTAGGGAGAATGG + Intronic
1081864755 11:46353430-46353452 CCTGGACCCCCAAGGGAGAATGG + Intronic
1081930658 11:46868590-46868612 TCCAACTCACCAAGGGAGCAGGG + Exonic
1082118620 11:48355387-48355409 TCTACCCCACAAAGAGAGAATGG + Intergenic
1082255703 11:50029914-50029936 TCTACCCCACAAAGAGAGAATGG - Intergenic
1085687035 11:78632921-78632943 TCTGAGCCACAGAAGGAGAAGGG + Intergenic
1085777024 11:79376209-79376231 TGAAACCCACCAAAGGAGAAGGG - Intronic
1086392622 11:86381172-86381194 TCTGTCCCACCTAAGGAGAAAGG - Intronic
1088009005 11:104976098-104976120 TCTAACCCTCCCAGGAAGAATGG + Intergenic
1089939440 11:122399751-122399773 GGTGACCCACCTAGGAAGAAGGG - Intergenic
1091103491 11:132897373-132897395 TCTGACCTACCAAGCCAGGAAGG + Intronic
1093178260 12:15937665-15937687 TGTTAACCACCAAAGGAGAAGGG - Intronic
1093180618 12:15962980-15963002 TCTGATTCACCAGGGAAGAATGG - Intronic
1097680766 12:62646962-62646984 TCTGACCCAAAAAGGAAAAAAGG - Exonic
1098609009 12:72432097-72432119 TCAGGCCCAGCAAAGGAGAAAGG - Intronic
1098734385 12:74080629-74080651 TCTTGCCCAGAAAGGGAGAAGGG + Intergenic
1099997785 12:89797355-89797377 GATGATCCACCAAGGCAGAAAGG - Intergenic
1102211217 12:111128574-111128596 TCTGACCCTCCAAGCCATAAAGG - Intronic
1103003515 12:117404268-117404290 TCTGACCTCCCAAGAGAGGAAGG - Intronic
1104034485 12:125089024-125089046 TCTGATGTACCATGGGAGAAGGG + Intronic
1104298700 12:127542804-127542826 TCTGACCTACCAAGGGGTGAAGG + Intergenic
1106123824 13:26883625-26883647 TCTAATCCTCCAAGTGAGAAGGG - Intergenic
1108082438 13:46750657-46750679 TCTGAGCCCCCAATGGAGAAGGG - Intronic
1111235239 13:85400630-85400652 TCCCACCCACTAAGGAAGAATGG + Intergenic
1112306235 13:98276852-98276874 TGTGACCCAGCAAGGGGGCATGG + Intronic
1113165953 13:107442214-107442236 TCTGGGCCACCAAGAGAGCAAGG - Intronic
1113511276 13:110856660-110856682 TCTGACCCAAGAGGGCAGAATGG - Intergenic
1116008543 14:39323970-39323992 TATGATCCACCAAAGGAGGATGG + Intronic
1116520384 14:45839685-45839707 TCTGTCCCCCCATGGTAGAAAGG + Intergenic
1117737061 14:58778149-58778171 TCTGACCCACCAAGAGAAATAGG + Intergenic
1118940243 14:70328224-70328246 TGAGTCCCAACAAGGGAGAAGGG + Intronic
1119257288 14:73209187-73209209 TCTGCCCCACCAACTCAGAAGGG + Intronic
1121519668 14:94577368-94577390 TCTCTCCAACCACGGGAGAATGG + Intronic
1123390636 15:19868199-19868221 TCTGACCCACCAACTGACAATGG + Intergenic
1127264198 15:57348186-57348208 ACAGACCCACCTAGGGAGACTGG + Intergenic
1128334696 15:66778434-66778456 TCTGCCCCACCCATGGAAAAAGG - Intronic
1128809098 15:70557040-70557062 TCACATCCACCGAGGGAGAAGGG - Intergenic
1129379966 15:75158615-75158637 CCTGACCCTCCCAGGGAGAGTGG + Intergenic
1131536384 15:93241261-93241283 TCTTACCAAGCAATGGAGAAAGG - Intergenic
1134357823 16:13500777-13500799 TCTAACTAACTAAGGGAGAAAGG + Intergenic
1136479118 16:30530748-30530770 TCTGGCCTACCCAGGGAGGAAGG - Intronic
1138120542 16:54397671-54397693 TTTGCCCCACCAGGGAAGAAGGG + Intergenic
1139330835 16:66188668-66188690 TCTGATGCACCAAGAGACAAGGG - Intergenic
1145868532 17:28255940-28255962 TGTGACCCACAAAGGGACAAAGG + Intergenic
1145924707 17:28637830-28637852 ACTTACCAACCAAGGCAGAAAGG + Exonic
1148655615 17:49281067-49281089 TCTGGTCCAACAAGGGGGAAAGG + Intergenic
1149368473 17:55968998-55969020 ACTGACCCACCCAGGCAAAATGG + Intergenic
1151702267 17:75749849-75749871 CCTGAGCTGCCAAGGGAGAAAGG + Intronic
1152286358 17:79415387-79415409 CCTCCCCCACCCAGGGAGAAGGG + Intronic
1154530766 18:15342469-15342491 TCTGACCCACCAACTGACAATGG - Intergenic
1156263574 18:35466870-35466892 TCTGACCGACCCAGGGAGTGGGG - Intronic
1158029888 18:52950550-52950572 TTTAACTCACCAAGAGAGAAGGG + Intronic
1159958047 18:74533692-74533714 TCTGACCCACCAAAGAAGAAAGG + Intergenic
1161199814 19:3008367-3008389 TCTGACCCCCCAGGGGACACTGG - Intronic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1163775681 19:19216000-19216022 TCTGACCCACAAAGAAAGTAAGG + Intronic
1165081875 19:33311553-33311575 TCAGACCCACCTAGGGAAATGGG + Intergenic
1165462351 19:35951584-35951606 GCTGGCGCACCATGGGAGAAGGG + Intergenic
927022944 2:19036292-19036314 TCTGAGCTTCCAAGGGAGACAGG + Intergenic
928497010 2:31843239-31843261 TCTCACACACCAAGGTAAAATGG - Intergenic
928828419 2:35448059-35448081 TCTGACCCCCCATGGAAGGAAGG - Intergenic
928894685 2:36247180-36247202 TCTGTCCTACCTGGGGAGAATGG - Intergenic
929961866 2:46503059-46503081 TCAGCCCCACCAAGGGACTAGGG - Intronic
930489215 2:52046759-52046781 TCTAACACACCACTGGAGAATGG - Intergenic
930562516 2:52978192-52978214 TCTTACCCAGCAAGGGCTAATGG + Intergenic
932121112 2:69101312-69101334 TCTGAACCACCATGCGAAAAGGG - Intronic
932735811 2:74253495-74253517 CCTGAGCCTCCAAGGGCGAAGGG - Intronic
933042475 2:77487182-77487204 TCTGCCCCACCAACTCAGAAGGG - Intronic
936403649 2:112184252-112184274 TCTGACCCACCAAGGGAGAACGG + Intronic
947819255 2:233059264-233059286 TCCGGCCCACCAAGGCCGAAGGG - Intergenic
948505762 2:238426272-238426294 TCTAACTCAGCAGGGGAGAATGG + Intergenic
949009558 2:241670812-241670834 GCTGAGCCACCCAGGGAGACAGG + Intronic
1169868815 20:10229990-10230012 TGGGACCTACCAAAGGAGAAAGG + Intronic
1170763589 20:19272727-19272749 ACTGAACCACCAAGGGAGGAGGG - Intronic
1171423177 20:25032559-25032581 TCTGCCCCGCCCAGAGAGAAAGG - Intronic
1171425248 20:25044781-25044803 GCTGGCTCACCAGGGGAGAAGGG + Intronic
1173585831 20:44182421-44182443 TCTGACAAACCAAGGCAGCAGGG + Intronic
1174369018 20:50073709-50073731 TGTGACCCACCAAGAGAGGAAGG + Intergenic
1175902021 20:62363710-62363732 TCTGGCCCCCCAAGGGAGGCTGG - Intronic
1175912793 20:62412744-62412766 TCAGGCCCACCTGGGGAGAAGGG + Exonic
1175963504 20:62648618-62648640 TCTGCCCCATCACGGGAGGAGGG - Intronic
1176766644 21:13025996-13026018 TCTGACCCACCAACTGACAATGG + Intergenic
1179711868 21:43268178-43268200 TCAGGACCACTAAGGGAGAAGGG - Intergenic
1180513773 22:16120275-16120297 TCTGACCCACCAACTGACAATGG + Intergenic
1181971931 22:26697416-26697438 TCTAACCCACCAGGGGTGGAAGG - Intergenic
1182669535 22:31984193-31984215 TCTGGCACAGCTAGGGAGAAGGG + Intergenic
949388511 3:3532848-3532870 TATGACCCACCAGCTGAGAATGG - Intergenic
950426191 3:12925929-12925951 TCTGAGGCCCCAAGGGAGAAGGG - Intronic
950460698 3:13120661-13120683 TCTGGTGCACCAAGGGAGGAGGG + Intergenic
950866384 3:16192652-16192674 TCAGCCCCACCAGGGGAGAAGGG + Intronic
950922802 3:16712400-16712422 TCAGAAACAACAAGGGAGAAGGG - Intergenic
951654998 3:24996702-24996724 TCTGAGCAACCAAAGGATAAAGG - Intergenic
953964924 3:47296975-47296997 TCAGATCCAGCAAGGTAGAATGG - Intronic
954630580 3:52045665-52045687 TCTGACCCAGCCAGAGACAATGG + Intergenic
956058909 3:65330107-65330129 TTTGAACCACTGAGGGAGAAGGG + Intergenic
956458889 3:69451666-69451688 TCTTACCCACCAGAGAAGAAAGG - Intronic
958603924 3:96333528-96333550 TCTCCCCCATCATGGGAGAAAGG - Intergenic
960532383 3:118779735-118779757 CAAGACCCACCAAGGCAGAATGG + Intergenic
960843624 3:121986368-121986390 TCTGACCCAGCAGGGAATAAGGG + Intergenic
968768134 4:2485464-2485486 TGTGAGACACCCAGGGAGAAAGG - Intronic
969450089 4:7268111-7268133 ACTGCCCCACAAGGGGAGAAGGG - Intronic
970411210 4:15809520-15809542 TCAGACCCACCAAGTGAGAATGG - Intronic
971777690 4:30988132-30988154 TCTGAATCACCACGTGAGAAAGG + Intronic
973535257 4:51875048-51875070 TATGACCCACAAAGCCAGAATGG - Intronic
973641719 4:52909562-52909584 GCGGACCAAGCAAGGGAGAAAGG + Intronic
977723306 4:100266215-100266237 TCAGATTCACCAAGGTAGAAAGG - Intergenic
980146803 4:128995948-128995970 TCTGGCCAACCAAGGGAGAATGG - Intronic
981642258 4:146958183-146958205 TCTGAACCATCAAGAGAAAAGGG + Intergenic
982350284 4:154407815-154407837 TCTGACCTACCAATAGAAAATGG - Intronic
985236476 4:187880787-187880809 TCTGAGCCAGCATGGGAGAGCGG + Intergenic
985877429 5:2610415-2610437 TCAGACCCAACCAGTGAGAATGG - Intergenic
985923383 5:2996832-2996854 TCTGACCCTCCAAGGGCGTGTGG + Intergenic
989018559 5:36971220-36971242 CCTGAACCACAAAGTGAGAATGG + Intronic
992433455 5:76732074-76732096 TCTGCCCCTCAAAGGGACAAAGG - Intronic
992442148 5:76806304-76806326 TATGACTCACCAAGGAAGAAGGG + Intergenic
993879511 5:93346220-93346242 TCTGACTGGGCAAGGGAGAATGG + Intergenic
998132447 5:139658193-139658215 TCTGACCGCCCCAGGAAGAAAGG - Intronic
999366325 5:151026134-151026156 TCTACCCCAGCTAGGGAGAAAGG - Intronic
1002257263 5:177967196-177967218 TCTGAACCACAAAGGGTGGAGGG + Intergenic
1004243946 6:13954351-13954373 TCTAACCAACCAATGGGGAAGGG - Intronic
1006719031 6:36138319-36138341 TCAGACCCACCAGGAGAGCAAGG + Intronic
1010208073 6:73340883-73340905 TCTTAACCTCCAAGGTAGAAAGG + Intergenic
1014853137 6:126365809-126365831 TCTGACCCACAAAGAATGAAAGG + Intergenic
1015690600 6:135917902-135917924 TCTGGCCAACCAAAGGAGAGCGG - Intronic
1016428245 6:143956836-143956858 GCTGAACTACCAAGGGGGAAGGG + Intronic
1023086421 7:36573895-36573917 TCAGAACCAGCAAGAGAGAAAGG - Intronic
1023250438 7:38254528-38254550 CTTGACCCTTCAAGGGAGAATGG + Intergenic
1024159616 7:46660906-46660928 TCTGTCCCTCCAAGCCAGAATGG - Intergenic
1025839586 7:65133213-65133235 TCTGCAGCCCCAAGGGAGAAGGG - Intergenic
1025883481 7:65562752-65562774 TCTGCAGCCCCAAGGGAGAAGGG + Intergenic
1025889964 7:65639854-65639876 TCTGCAGCCCCAAGGGAGAAGGG - Intergenic
1028799742 7:94949056-94949078 TCTTAAATACCAAGGGAGAATGG + Intronic
1029282427 7:99444676-99444698 TCTGACCCACCAAGGGTTCAGGG - Intronic
1029713652 7:102313975-102313997 TGTGACCCACCTTGGGAAAAAGG + Intronic
1031852512 7:126882131-126882153 TCTGCAGCCCCAAGGGAGAAGGG + Intronic
1039526366 8:38219946-38219968 TTTTACCCACCAAGGGAAACTGG - Intergenic
1041675863 8:60538776-60538798 TGTGCCCTACCAAGGTAGAAAGG + Intronic
1042964419 8:74335274-74335296 TTTAATCCACCATGGGAGAAAGG - Intronic
1044524148 8:93232543-93232565 CGTAAACCACCAAGGGAGAAAGG + Intergenic
1045452206 8:102338579-102338601 CCTGTCCCAGGAAGGGAGAACGG - Intronic
1046430531 8:114120773-114120795 TTTCACTCACCAAGGGAGGAAGG + Intergenic
1046731243 8:117728541-117728563 TCTGTCTCACCATGTGAGAAGGG - Intergenic
1047377647 8:124317800-124317822 TCAGAGCCAGCAAGGGAGAAAGG - Intronic
1049237671 8:141520222-141520244 GCTGTCCCACCCAGGGAGAGTGG + Intergenic
1053708465 9:40780210-40780232 TCTGACCCACCAACTGACAATGG - Intergenic
1054418374 9:64901005-64901027 TCTGACCCACCAACTGACAATGG - Intergenic
1057883462 9:98810004-98810026 TCTTACCCAGCCAGAGAGAAAGG + Intronic
1059487800 9:114640494-114640516 TTTCACCCACCAAGGAAAAAGGG - Intronic
1186932930 X:14414499-14414521 TCTGAATGACCAAGGGGGAATGG + Intergenic
1187942758 X:24398045-24398067 GCTGACCCAGTAAGGGAGCATGG + Intergenic
1189228329 X:39432266-39432288 TCTGTCCCTCCAAGGGGAAAGGG - Intergenic
1193274454 X:79569949-79569971 TCTCACCCAGCCAGGAAGAATGG + Intergenic
1201219238 Y:11750666-11750688 TCAGAGCCAGCGAGGGAGAAAGG - Intergenic
1201351637 Y:13049916-13049938 TCTGAAGAACCAATGGAGAAGGG - Intergenic
1201442125 Y:14019707-14019729 TCTTACTCACTAAGGGAGGAAGG - Intergenic