ID: 936410296

View in Genome Browser
Species Human (GRCh38)
Location 2:112252581-112252603
Sequence CCAATCATGGAGGAACTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936410296 Original CRISPR CCAATCATGGAGGAACTGGT AGG (reversed) Intronic
904367567 1:30024544-30024566 CCAACCATGGGGGACCTGGGTGG - Intergenic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
905855523 1:41309088-41309110 CCAATCATGGCGGAAGGGGAAGG - Intergenic
917692402 1:177482741-177482763 CCAGACATAGAGGAACTGGCAGG + Intergenic
922236932 1:223729009-223729031 CCGAGAATGGAGGGACTGGTTGG - Intronic
922925700 1:229345100-229345122 CCAATCATGGTGGAAGGGGAAGG - Intergenic
922929251 1:229376036-229376058 CCAATCATGGTGGAAGAGGAAGG + Intergenic
923264754 1:232303791-232303813 CCATTCATGGAGGATCTTGCTGG - Intergenic
924847873 1:247790969-247790991 CCACTCCTGGTGGTACTGGTTGG - Intergenic
1063399906 10:5733130-5733152 CCAGTCATGTATGAACTTGTAGG - Intronic
1064521569 10:16208740-16208762 CCAATCCTGGAGAAACAGATAGG - Intergenic
1064927087 10:20581399-20581421 ACAATCATGGCGGAAGTGGAAGG - Intergenic
1066298608 10:34077392-34077414 CCAATCTTGAAGGAACTGCCAGG + Intergenic
1069428538 10:68312090-68312112 CCATTCATTGAGGAACAGTTAGG + Intronic
1071028628 10:81144784-81144806 CCCATCCTGTAGGAAGTGGTGGG - Intergenic
1071330665 10:84556086-84556108 ACAATCATGGAGGAAGTGAAAGG + Intergenic
1076440193 10:130476324-130476346 TCAATGGTGGAGGAAGTGGTGGG - Intergenic
1078024794 11:7684733-7684755 CCAGTGATGTATGAACTGGTGGG + Intergenic
1079638547 11:22775488-22775510 CCTGGCATGGAGGAATTGGTCGG + Intronic
1079986734 11:27207716-27207738 CCAATCATGGAGGAAAGGGAAGG - Intergenic
1082674037 11:56073525-56073547 CCAATCATGTAGGAACACTTAGG - Intergenic
1083915277 11:65739030-65739052 CCACTCCTGGTGGTACTGGTTGG + Intergenic
1084440701 11:69171194-69171216 GCAATCATGAAGGACCTGGTGGG - Intergenic
1085804303 11:79620486-79620508 CCATCCATGTAGGAACTGGATGG - Intergenic
1086782697 11:90928219-90928241 ACAATCATGGTGGAAGTGGAAGG + Intergenic
1086798783 11:91144548-91144570 CCAAATGTGGGGGAACTGGTAGG - Intergenic
1089672780 11:120067993-120068015 ACAGCCATGGAGGCACTGGTGGG - Intergenic
1091300910 11:134507713-134507735 CCAATCCTTGAGGACCTGTTGGG - Intergenic
1092380752 12:7995107-7995129 CCATTCCTTGAGGAACTAGTTGG - Intergenic
1096820628 12:54231322-54231344 CCCATCCTGTAGGAAGTGGTGGG + Exonic
1097279968 12:57839069-57839091 CATATGAAGGAGGAACTGGTTGG - Intronic
1098808809 12:75057368-75057390 CCAATCAAGTAGGAACAAGTAGG + Intronic
1099018456 12:77374028-77374050 GCAATCATGGAGGAAGTTGAAGG + Intergenic
1099144139 12:79017644-79017666 CCAATGTTGGAGGAAGAGGTTGG + Intronic
1099184446 12:79502671-79502693 CCAATCATGGAGGACGGGGAAGG + Intergenic
1099246719 12:80201353-80201375 CCAATCATGGTGGAAGGTGTAGG + Intergenic
1100380717 12:94059235-94059257 CCACTCATGGTGGAAGTGGAAGG - Intergenic
1101650860 12:106675918-106675940 CCAATTAGGCAGGACCTGGTGGG + Intronic
1101752421 12:107593341-107593363 CCCATCATGGAGCATCTTGTGGG + Intronic
1102679678 12:114682992-114683014 CCGATCATGGATCAATTGGTGGG - Exonic
1103369055 12:120404389-120404411 CCAACCCTGGAGGCACAGGTGGG - Intergenic
1104124550 12:125833779-125833801 CCAATCATGGTGGAAAGGGAAGG - Intergenic
1105023521 12:132833845-132833867 GGAATCATGCAGGTACTGGTGGG + Intronic
1105783549 13:23725333-23725355 CCAATCATGAAATAAATGGTAGG - Intergenic
1106993161 13:35448612-35448634 CCAGTCATGAAGGAACTTGGAGG + Intronic
1108266952 13:48720416-48720438 GCAAACATGGAGGACCTGGAGGG + Intergenic
1111431248 13:88150714-88150736 CCAGTCCTGGTGGTACTGGTTGG + Intergenic
1113570236 13:111348570-111348592 ACAATCATGGAGGAAGGGGAAGG + Intergenic
1114938363 14:27573502-27573524 CCAATCATGTGAGCACTGGTGGG - Intergenic
1116239541 14:42323427-42323449 CCAATCCTGGTGGTACTGGCTGG + Intergenic
1117492215 14:56260493-56260515 ACAGTCATGAAGGAACTGTTTGG + Intronic
1120327726 14:83051477-83051499 CCACTCCTGGTGGTACTGGTTGG - Intergenic
1121254556 14:92521609-92521631 CCAATCATGGTGGAAGGGGAAGG - Intronic
1121474885 14:94189919-94189941 TCAATCATTCAGGAACTGCTGGG - Intronic
1123826074 15:24083560-24083582 ATAATCTTGGAGAAACTGGTTGG - Intergenic
1124606835 15:31175713-31175735 CCAGGCCTGGAGGAGCTGGTGGG + Intergenic
1126216403 15:46159013-46159035 ACAATCCTGGAGAAACAGGTAGG + Intergenic
1128634227 15:69292971-69292993 CCACTCAGGGAGGAACGGGAAGG - Intergenic
1129236408 15:74226188-74226210 CCGATTGTGGAGGAAGTGGTGGG + Intergenic
1131141697 15:89981637-89981659 CTAATAATGAAGGAACTGGTAGG - Intergenic
1131677861 15:94689545-94689567 ACAATCATGGTGGAAGTGGAAGG - Intergenic
1133403769 16:5507375-5507397 CCACTGATGGAGAAACTGGGGGG - Intergenic
1139482384 16:67237589-67237611 GCAGTCATGGGGGAACAGGTAGG + Intronic
1139490247 16:67282118-67282140 GCATTCATGGAGGGACTGGGAGG - Intronic
1140115252 16:72036206-72036228 GCAATCTTGGAGGAGCTGGAGGG + Intergenic
1140953028 16:79837495-79837517 CCAATCATGGAGAAAATGCTAGG - Intergenic
1141111796 16:81276144-81276166 CCATTCATGGAGGACCCGCTAGG + Intronic
1141848868 16:86630468-86630490 CCATTCATGGAGGAACCGCCAGG - Intergenic
1141878875 16:86845105-86845127 CCAATCTTGGAGGAACTCTTCGG - Intergenic
1141914701 16:87087326-87087348 CCAGTCACTGAGGAAATGGTGGG + Intronic
1142995752 17:3759325-3759347 TCACTCATGGAGGAAGTGGCTGG - Intronic
1143521625 17:7447391-7447413 GAAATCATGGAGGAATTGGAGGG - Intronic
1145370344 17:22302129-22302151 CCAATCAAGCAGAAACAGGTTGG - Intergenic
1146066024 17:29636107-29636129 TCAAGGATGGAGGAACTGGGTGG - Exonic
1146560240 17:33862647-33862669 CCAGTCATGGAAGACCTGGTTGG - Intronic
1147518416 17:41144073-41144095 CAAATCCTGGAAGAAATGGTAGG + Intergenic
1147632143 17:41939051-41939073 CCCAACAAGGATGAACTGGTTGG + Exonic
1152290679 17:79438317-79438339 ACTATCATGGAGGAGCTGGTTGG - Intronic
1155386077 18:25278980-25279002 CAAATTGTGGAGAAACTGGTGGG + Intronic
1155929065 18:31686167-31686189 CTAATCATGCAGGAAGTGGCGGG + Intergenic
1156632682 18:38988826-38988848 ACAATCATGGAGGAAGAGGGAGG - Intergenic
1157000609 18:43518867-43518889 ACAATCATGGAGGAAGGGGAAGG - Intergenic
1158286121 18:55885147-55885169 CCATTCATAAAGGAACTGTTAGG - Intergenic
1158366964 18:56747183-56747205 CAAAACATGGAGGAAGTGGTGGG + Intronic
1158757783 18:60347557-60347579 CTAATCATGGAGAATCTGATAGG + Intergenic
1159076133 18:63683987-63684009 CGGATCATGTAGGAAGTGGTGGG - Intronic
1159993846 18:74942385-74942407 CCAAACATGGAGGAAAGGCTGGG + Intronic
1160624670 18:80195096-80195118 CCAAGCGTGGAGGCACAGGTTGG - Intronic
1165068683 19:33242930-33242952 AACATCATGGAGGAACTGGAAGG + Intergenic
1165661326 19:37582989-37583011 CAAATCATGTAGGACCTTGTTGG - Intronic
1166042597 19:40212882-40212904 CCAAAGAAGGAAGAACTGGTCGG + Exonic
1166563672 19:43750164-43750186 CAAATCATGTAGGACCTGGTAGG - Intronic
1168486249 19:56764834-56764856 CCGATCGTGGAGGACCTGGAGGG - Intergenic
1168655774 19:58126532-58126554 ACAACCATGGAGGTAGTGGTGGG + Exonic
932657432 2:73622393-73622415 CCAATCATGGCGGAACGTGAAGG - Intergenic
936410296 2:112252581-112252603 CCAATCATGGAGGAACTGGTAGG - Intronic
940410019 2:153350714-153350736 TCAACCATGGTGGAGCTGGTTGG + Intergenic
1172870538 20:38132786-38132808 CCAAACATCGAGGACCTGGGAGG - Intronic
1173320660 20:41984328-41984350 ACCAGCAAGGAGGAACTGGTTGG - Intergenic
1173587446 20:44193615-44193637 CAGATCATGGAGGGCCTGGTAGG - Intergenic
1174105512 20:48159908-48159930 CCAGTCAGGCAGGAACTGTTAGG - Intergenic
1177786288 21:25675102-25675124 CCAATCATGGAGGAAGGCGAAGG + Intronic
1180697765 22:17764105-17764127 CCCATCCTGTAGGAAGTGGTGGG + Intronic
1182600934 22:31463264-31463286 CCAGTCAGGGAGGAAGGGGTGGG - Intronic
1183377218 22:37472365-37472387 CCAAACATGGGGGAGCTGGGAGG - Intronic
949338439 3:3002933-3002955 CCATTCGTGGATGAGCTGGTTGG - Intronic
949575049 3:5331022-5331044 ACAATCATGGAGAAACTTGAAGG + Intergenic
951725669 3:25755544-25755566 CCAATCATTGAGGGATTAGTTGG - Intronic
952822457 3:37496867-37496889 ACACTAATGGAGGAACTGCTGGG + Intronic
953409285 3:42680635-42680657 CCCATCACTGAGGAACTTGTTGG - Intergenic
953468868 3:43149900-43149922 ACAATCATGGTGGAAGTGGATGG + Intergenic
954603565 3:51891526-51891548 CCAAGCATGGAGAAACTGCATGG + Intergenic
955154198 3:56400185-56400207 ACATTTATGGAGGAACTGATAGG + Intronic
955691400 3:61594125-61594147 CCAAACATTCAGGAACAGGTAGG - Intronic
958084875 3:88794713-88794735 CGAGTCAGGGAGGACCTGGTGGG - Intergenic
959873247 3:111352215-111352237 CCAAACATTGAGGGAGTGGTGGG - Intronic
960844914 3:121996295-121996317 ACACTCATGGAGGATCTGGAAGG - Intronic
961909784 3:130302531-130302553 CCATTCCTGGTGGTACTGGTTGG - Intergenic
962387809 3:134946791-134946813 CCAATCATGGAGGAAGGTGGAGG - Intronic
963810642 3:149773214-149773236 CCAATAAGGGAGGGACTGGCAGG - Intronic
967811385 3:193763999-193764021 CAAGTCATGTAGGACCTGGTGGG - Intergenic
971299868 4:25433215-25433237 ACAAGCAGGGAGGAACTGGCTGG + Intergenic
971957920 4:33446442-33446464 CCAATCAAGGAATAACTGTTGGG - Intergenic
976205308 4:82618556-82618578 ACAAGCCTGGAGGAACTGGCTGG + Intergenic
977037781 4:91976741-91976763 ACAATCATGGAGGAAGTTGAAGG - Intergenic
978359505 4:107914710-107914732 CCAATGATTAAGGTACTGGTGGG - Exonic
978836122 4:113151392-113151414 CCACTCACGGAGGAAAGGGTAGG + Intronic
986748619 5:10765221-10765243 CCCATCATGCAGGGTCTGGTAGG - Intergenic
987178140 5:15338001-15338023 CCAAACATGCAGCAACAGGTAGG - Intergenic
987463598 5:18245538-18245560 CCAATCATGGAAGAAAGGGAAGG - Intergenic
991126211 5:63072539-63072561 CCAATCATGGAGGAAGGCGAAGG - Intergenic
996615372 5:125435256-125435278 ACAATCAGGGAGGAACTGAAAGG - Intergenic
996795608 5:127343385-127343407 TCTATCATGGAGGAGCGGGTGGG - Intronic
998469714 5:142374339-142374361 CCAATCCTGAAGGATGTGGTGGG - Intergenic
999085516 5:148885454-148885476 ACAATCATGGAGGAAGGGGAAGG + Intergenic
1000986286 5:167864082-167864104 CCATTCAATGAGGAACGGGTGGG + Intronic
1004167636 6:13270908-13270930 CCAATCATGGAGGAAGGTGAAGG + Intronic
1006522702 6:34581271-34581293 CCAATCATAGTGGTAGTGGTTGG - Intergenic
1006612217 6:35301008-35301030 CCAGTCAAGGAGGAAGTGGTAGG - Intronic
1007321825 6:41033278-41033300 GCACTTAGGGAGGAACTGGTAGG + Intronic
1008552554 6:52646966-52646988 CCATTCCTGGAGGAAGTGGAAGG - Intergenic
1016106182 6:140165741-140165763 ACAGTCATGGAGGAAGTGATTGG + Intergenic
1016492007 6:144615898-144615920 CTGATCATGTAGGACCTGGTAGG - Intronic
1017846840 6:158265811-158265833 CCAATGATCTAAGAACTGGTGGG - Intronic
1017993406 6:159509919-159509941 CCACTCATGGAGGCACTGAAAGG - Intergenic
1019268886 7:134844-134866 CATCTCATGGAGGAACTGGGAGG - Intergenic
1022195970 7:28067578-28067600 CCAATGATGGAGCAAGTGTTGGG + Intronic
1023185043 7:37524355-37524377 GCAGTCATGCAGGGACTGGTAGG + Intergenic
1025295639 7:57773630-57773652 CCAATCAAGCAGAAACAGGTTGG - Intergenic
1028454016 7:91018770-91018792 ACAATCATGGAGGAACATGAAGG - Intronic
1029970487 7:104783776-104783798 CAAGCAATGGAGGAACTGGTTGG - Intronic
1030221879 7:107106648-107106670 CCACTCCTGGTGGCACTGGTTGG + Intronic
1031418203 7:121518270-121518292 ACAATCATGGTGGAAGTTGTAGG - Intergenic
1031728497 7:125267308-125267330 AAAATCATGGTGGAACTGGAAGG - Intergenic
1031819661 7:126484249-126484271 CCAATGATGGAGCAACTGCAGGG + Intronic
1036648818 8:10629168-10629190 CCAATCATGGAGCAAGTGCATGG + Intronic
1038289669 8:26237512-26237534 TCAATCATGGCGGAACTTGAAGG - Intergenic
1039428960 8:37510839-37510861 CCAATCATGGAGGAAGGGAAAGG + Intergenic
1043100990 8:76045448-76045470 CCAATGATGAAGAAGCTGGTAGG + Intergenic
1043222558 8:77685802-77685824 TCAATCATGGAGGAAATTGAAGG - Intergenic
1044250227 8:89997713-89997735 ACAATCATGGAGGAATGGATAGG - Intronic
1046405065 8:113762709-113762731 GCCATCAGGGATGAACTGGTGGG - Intergenic
1046814417 8:118568383-118568405 CAGATCATGCAGGATCTGGTAGG + Intronic
1049080006 8:140435179-140435201 ACTATCCTGGTGGAACTGGTGGG - Exonic
1050362960 9:4847993-4848015 GACATCATGGAGGAAGTGGTAGG - Intronic
1050992755 9:12173549-12173571 CCACTCCTGGTGGTACTGGTTGG + Intergenic
1053125487 9:35577353-35577375 CCACTCCTGGTGGTACTGGTTGG - Intergenic
1055203492 9:73697046-73697068 CCAATCTTGGAAGAACTTATTGG - Intergenic
1055392530 9:75838390-75838412 CAGATCATGGAGAACCTGGTGGG - Intergenic
1055442797 9:76353266-76353288 CCAGTCAAGGAGCAACTTGTCGG + Intronic
1056132658 9:83601197-83601219 CCAATCCTGGAAGCCCTGGTGGG + Intergenic
1057898452 9:98928468-98928490 GCAATCATGGAAGAATTGGAAGG - Intergenic
1058012705 9:99996128-99996150 CCCAACATGGAGGTGCTGGTAGG + Intronic
1185715487 X:2338678-2338700 CCACTCATGGTGGAACGGGAAGG - Intronic
1186188337 X:7043422-7043444 CCACTCATGGTGGAACGGGAAGG - Intergenic
1189394063 X:40604363-40604385 ACAATCATGGAGGAAGGGGAAGG + Intronic
1192007532 X:67233563-67233585 CAAATCTTGGAGGAACAGGCAGG - Intergenic
1192072719 X:67958201-67958223 CCTCTCAAGGAGGAAATGGTTGG + Intergenic
1195522463 X:105847147-105847169 CAAATCAGTGAGGAACTGGAAGG + Intronic
1197684732 X:129427370-129427392 CCAATGATGGTGGATCAGGTAGG + Intergenic
1198928021 X:141821564-141821586 CAAATCCTGGTGGTACTGGTTGG + Intergenic
1201638332 Y:16150742-16150764 ACAATCATGGTGGAAGTGGATGG + Intergenic