ID: 936412518

View in Genome Browser
Species Human (GRCh38)
Location 2:112273339-112273361
Sequence GTCTTTAATTGCCTCAGTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936412518 Original CRISPR GTCTTTAATTGCCTCAGTTA AGG (reversed) Intergenic