ID: 936413355

View in Genome Browser
Species Human (GRCh38)
Location 2:112280658-112280680
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 3, 1: 0, 2: 2, 3: 20, 4: 283}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936413351_936413355 9 Left 936413351 2:112280626-112280648 CCTGAACTGAGTGCTGTGGGGGT 0: 3
1: 1
2: 0
3: 12
4: 173
Right 936413355 2:112280658-112280680 AAGGCTTCTGGGAGACATCATGG 0: 3
1: 0
2: 2
3: 20
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900852888 1:5157744-5157766 AAGGCTTCAGGGACTCACCACGG + Intergenic
901121802 1:6901277-6901299 AAGCCTTCTGGAAGAAAACATGG + Intronic
901284154 1:8063148-8063170 AAGGCTGCAGGGAGCCATGAGGG + Intergenic
902190033 1:14755899-14755921 GGGGCGTCTGGGAGACTTCAAGG - Intronic
902757521 1:18558652-18558674 AAGTCTTCTGGGATACATCCAGG - Intergenic
903181546 1:21607633-21607655 GAGGATTCTGGGAGACAGCAAGG - Intronic
903237982 1:21963047-21963069 AAGGTTTCTGTGAGAATTCAAGG - Intergenic
903640718 1:24858139-24858161 AAGGCTGCTGTGAGCCATGATGG - Intergenic
906749849 1:48249060-48249082 AAAGGTTTTGGGAGAAATCAGGG - Intergenic
906936350 1:50217231-50217253 AAAGGTACTGGGAGACATCGGGG + Intergenic
907319248 1:53592522-53592544 AGGGCTGCTGGGAGACAGCTGGG - Intronic
907905977 1:58784104-58784126 AAGGCCTTGGGGTGACATCATGG - Exonic
910170200 1:84369009-84369031 AAGGCTTCTGGGAGCCACCAAGG - Intronic
910206084 1:84750203-84750225 AAGGCTTCTATGAGACACTAGGG + Intergenic
910834630 1:91496268-91496290 AAAGCTTCTAGGAGAGCTCATGG - Intergenic
914238129 1:145831032-145831054 AAGGCTTCAGTGAGCCATGATGG + Intronic
915837978 1:159193226-159193248 AAGGCCTGCGGGAGACAGCATGG - Intronic
917752142 1:178063401-178063423 AAGGCTGCAGTGAGACATGATGG + Intergenic
917969886 1:180199752-180199774 GAGGCTTCTGCGAGACCTGAAGG + Exonic
918178520 1:182066219-182066241 AAGGCATCTGGGAGAGAGAAGGG + Intergenic
918631123 1:186719596-186719618 TTGGCTTCTGGGAGACCTCAGGG - Intergenic
920096177 1:203487865-203487887 GGGGCTTCTGGGAGACGTCCAGG - Exonic
920537718 1:206750350-206750372 AAGTCTTCTGGGAACCATGAGGG - Intergenic
920842344 1:209565338-209565360 AAGGCTTATGTGAGACCTCTTGG + Intergenic
921929687 1:220745145-220745167 TCTGCTTCTGGGAGACCTCAGGG - Intergenic
922995696 1:229957812-229957834 AAAACTTCTGGGATACAGCAAGG - Intergenic
923459952 1:234200528-234200550 GAGGCTCCTGGGAGAGATGATGG - Intronic
923628304 1:235632148-235632170 AAGGCTGCAGGGAGCCATGATGG - Intronic
924593004 1:245421307-245421329 AAGGACTCTGGGGTACATCATGG + Intronic
1063197496 10:3757358-3757380 AGTGCTTCTGAGCGACATCATGG + Intergenic
1063294214 10:4786520-4786542 AAGGCAGGTGGGAGGCATCACGG + Intergenic
1064083832 10:12330058-12330080 AAGGCTGCAGTGAGCCATCATGG - Intergenic
1064778491 10:18806892-18806914 AAGGCTGCTGTGAGGCATGATGG - Intergenic
1065005387 10:21375083-21375105 AAAGCTTCTGGAAGAAAACATGG + Intergenic
1065231815 10:23606168-23606190 AAAGTGTCTGAGAGACATCAGGG - Intergenic
1065845493 10:29739464-29739486 GAGGCCTCTGGGAGGCATCAGGG - Intergenic
1066360147 10:34722126-34722148 AAGGCTGCAGTGAGACATGATGG + Intronic
1067186435 10:44032184-44032206 GAGACTTCTAGGAGACACCAAGG + Intergenic
1067199853 10:44157818-44157840 AAGGCTACTTGGAGAAATAATGG + Intergenic
1067217659 10:44316480-44316502 AAGGCTTGTGGGAGGAGTCAGGG - Intergenic
1067382299 10:45786133-45786155 AAGGCTTCAGTGAGACACCCTGG - Intronic
1067889999 10:50126681-50126703 AAGGCTTCAGTGAGACACCCTGG - Intronic
1069949898 10:72011555-72011577 AAGGCTTCTGGCAGACAAGCTGG - Exonic
1071671499 10:87613147-87613169 GAGGCCTCTGGGTGACCTCAAGG + Intergenic
1073702196 10:105940093-105940115 GAGACCTCTGGGAGACAACAGGG - Intergenic
1074496119 10:113981485-113981507 AAGGATTATGGGTGACATAATGG + Intergenic
1075580422 10:123613588-123613610 AATGGTCCTGCGAGACATCATGG + Intergenic
1077693143 11:4367602-4367624 AAGGCATGTGGAAGACAGCATGG + Exonic
1078749317 11:14144841-14144863 AAGGCTTCTGGGAGTCAGATTGG + Intronic
1079282982 11:19104596-19104618 ATGACTTCTTGGAGAGATCAGGG + Intergenic
1079604236 11:22344447-22344469 AAGGCTTCTCAGAGTCCTCAGGG + Intronic
1080142108 11:28934071-28934093 AGGGTTTCTGGGATACATGATGG - Intergenic
1080391651 11:31853451-31853473 AATGTTTCTGGGAGAAAACAAGG + Intronic
1082833149 11:57634296-57634318 AAGGCAGCTGGGACAGATCATGG - Intergenic
1083474523 11:62907293-62907315 AAGGCTTCTGGGAGTCCCAACGG + Intergenic
1084006389 11:66325719-66325741 TAGGCCTCTGGCAGACACCACGG - Intergenic
1084272356 11:68036149-68036171 AGGGCTTCTGGCAGACCCCAGGG + Intronic
1084421578 11:69063176-69063198 AAGGCTGCTGGGAGGCTTCTGGG - Intronic
1085728941 11:78979770-78979792 AAGGCTTCTGGTAGAATCCAGGG + Intronic
1087045621 11:93841642-93841664 AAGGATTCTGTAAGACCTCAGGG + Intronic
1089206791 11:116770856-116770878 AAGGCTGCAGGGAGCCATGATGG - Intronic
1089509854 11:118989623-118989645 AAGGAATCTGTGAGACATCAGGG + Intergenic
1089744455 11:120607166-120607188 CAGGCTTCGGGGAGACATTCAGG + Intronic
1090368676 11:126229834-126229856 AAGGTTTCTGAAAGACATTAAGG - Intronic
1090755117 11:129783787-129783809 AAGGCTTGTGGCTGAAATCAAGG + Intergenic
1094109307 12:26844294-26844316 GAGGCTTCAGTGAGACATGATGG + Intergenic
1097033589 12:56106939-56106961 AGGGCTCCCGGGAGACAGCAAGG + Intronic
1099910382 12:88825206-88825228 AAGGATTCTAGGAGAAAACAAGG + Intergenic
1100501242 12:95175871-95175893 AAAACTTATGGAAGACATCAAGG + Intronic
1102807688 12:115796287-115796309 TAGGCATTTGGGATACATCAGGG - Intergenic
1103166997 12:118778759-118778781 AAGGCTTCATGCAGACACCAGGG + Intergenic
1103499405 12:121389277-121389299 AAGGCTGCAGTGAGCCATCATGG + Intronic
1104134465 12:125924068-125924090 TTGGCTTCTGGGAGGCCTCAGGG - Intergenic
1106202462 13:27551744-27551766 AAGGCTTCTGGGATGGAACAAGG + Intronic
1106488848 13:30197392-30197414 AGGGCTTCTGGGAGACAGAAGGG + Intergenic
1107881834 13:44839134-44839156 AAGGCTGCAGGGAGCCATGATGG + Intergenic
1113331927 13:109335735-109335757 AAGGCTTCTGGGGGAAATGTGGG + Intergenic
1113511670 13:110860447-110860469 TCGGCTTCTGGGAGGCCTCAGGG - Intergenic
1113530913 13:111026242-111026264 TCGGCTTCTGGGAGGCCTCAGGG + Intergenic
1113939146 13:114009682-114009704 AAGGGTGCTTGGAGACCTCACGG - Intronic
1114070800 14:19104631-19104653 AAGGTTTCTGAGGGACTTCAAGG + Intergenic
1114091461 14:19295375-19295397 AAGGTTTCTGAGGGACTTCAAGG - Intergenic
1116127442 14:40806664-40806686 ATTGCTTCTGGCAGACATGATGG + Intergenic
1116884576 14:50207444-50207466 AAGGCTACAGTGAGACATGATGG + Intronic
1117653427 14:57929855-57929877 AAAGCTTCTGTGAGAGCTCAGGG - Intronic
1118014405 14:61643662-61643684 ATGACTTCTGGGTGTCATCACGG + Intronic
1118936151 14:70290255-70290277 AAGACTTCAGGGATACAGCATGG - Intergenic
1118972147 14:70645937-70645959 GAGGCTTCTGGAATACATCTAGG + Intronic
1119978047 14:79047330-79047352 AAAGCTTCTAGGAGAAAACATGG + Intronic
1120997521 14:90427871-90427893 AAGGCCTCTGGGATTCAACATGG - Intergenic
1124583511 15:30984055-30984077 AAGGCATCTGGAAGAGACCAAGG + Intronic
1127397405 15:58553526-58553548 AAGGCTGCAGTGAGACATGATGG + Intronic
1128336462 15:66788876-66788898 ATGGCTTCTGGGGGAATTCAGGG + Intergenic
1128802337 15:70504785-70504807 AAGGTTCCTGGCAGTCATCAAGG + Intergenic
1131387962 15:92023184-92023206 AAGGCTGCAGGGAAATATCAAGG - Intronic
1131418439 15:92281997-92282019 AAGATTTCTGAGGGACATCAAGG + Intergenic
1131418518 15:92282846-92282868 AGGGCTTCTTGGAGAAATCACGG + Intergenic
1132081304 15:98868260-98868282 AAGGCTTCAGTGAGCCATGATGG + Intronic
1132204601 15:99977805-99977827 AGGGCTCCTGGGAGAAAGCAGGG - Intronic
1132362202 15:101225680-101225702 TTGGCTTCTGGGAGGCTTCAGGG - Intronic
1133711126 16:8402009-8402031 AAGGCTGCAGTGAGCCATCATGG + Intergenic
1134247077 16:12547957-12547979 CAGTCTTTTGGGAGACAGCATGG + Intronic
1137455562 16:48615250-48615272 AAGGCTATGGGGAGACCTCATGG - Intronic
1138407480 16:56809079-56809101 AAGACCTCTGGGATACATGAAGG - Intronic
1138679520 16:58674936-58674958 AGGGCTGCTGGGAGTCATCGAGG - Intronic
1138792524 16:59923177-59923199 AACTCTTCTGGGAGACAGCAAGG - Intergenic
1141484128 16:84327740-84327762 AAGACTTCCTGGAGACATCAAGG - Intronic
1142560155 17:804927-804949 AAGGCTTCAGGGAGAGACAAAGG + Intronic
1142909087 17:3071831-3071853 AAGTCTTCTGGGTGACAGCCTGG - Intergenic
1142925474 17:3232407-3232429 AAGTCTTCTGGGTGACAGCCTGG + Intergenic
1143554093 17:7650277-7650299 AGGGCTTCAGGGAGACGTGATGG + Intronic
1143933354 17:10455218-10455240 AAGGCTTCTGAGAAACTTCTAGG - Exonic
1145030683 17:19502528-19502550 AAGGCTTCAGGGAGCCACGAAGG + Intronic
1145123101 17:20278273-20278295 CAGGCTTCTGTAAGTCATCAAGG + Intronic
1145887910 17:28395755-28395777 AAGGGTTAAGGTAGACATCAAGG + Exonic
1149428231 17:56576223-56576245 AAGGCTGCAGTGAGCCATCACGG - Intergenic
1150325647 17:64254924-64254946 AAGGCTGCTGTGAGCCATGATGG - Intronic
1151121034 17:71793181-71793203 AAGGCCTCTGGGTCACTTCATGG + Intergenic
1151335660 17:73438186-73438208 CAGGCCTCTGGGAGTCCTCATGG - Intronic
1152258166 17:79252299-79252321 GAGCAGTCTGGGAGACATCAAGG - Intronic
1152290164 17:79435808-79435830 AAGGTGGCTGGGAGACATCGGGG - Intronic
1152346293 17:79754111-79754133 AAGGCTGCTGTGAGCCATGATGG + Intergenic
1152475906 17:80518100-80518122 AATGCTTCTAGGAGAACTCATGG - Intergenic
1153616070 18:6934877-6934899 ATGGTTTCTCGGAGAAATCATGG + Intergenic
1153719563 18:7888123-7888145 AATGCCTCTGGGAGACCTGAGGG + Exonic
1154492908 18:14934772-14934794 AAGGCATCTGGGAGCAGTCATGG + Intergenic
1156383578 18:36585945-36585967 CAGGCTTCTGGGAGCCTGCAGGG + Intronic
1157976422 18:52332786-52332808 AAGGCCACTGGGAGCCAGCATGG - Intergenic
1158020902 18:52840198-52840220 AAAGCTTCTGGGGAACATCAAGG - Intronic
1160662967 19:309594-309616 AAGGCTTCAGGGAGACGAGAAGG + Intronic
1160662972 19:309634-309656 AAGGCTTCAGGGAGACGAGAAGG + Intronic
1160662977 19:309680-309702 AAGGCTTCAGGGAGACGAGAAGG + Intronic
1160662987 19:309762-309784 AAGGCTTCAGGGAGACGAGAAGG + Intronic
1160662992 19:309804-309826 AAGGCTTCAGGGAGACGAGAAGG + Intronic
1160662997 19:309848-309870 AAGGCTTCAGGGAGACGAGAAGG + Intronic
1160663010 19:309970-309992 AAGGCTTCAGGGAGACGAGAAGG + Intronic
1160663015 19:310014-310036 AAGGCTTCAGGGAGACGAGAAGG + Intronic
1160985007 19:1834477-1834499 AAAGCTTCAGCGAGCCATCATGG - Intronic
1161008880 19:1950583-1950605 GAGGCCTCTGGGAGACAGGAGGG + Intronic
1161534500 19:4810741-4810763 AAGGCTGCAGTGAGATATCATGG - Intergenic
1162963984 19:14147089-14147111 AGGGCTTCTGTGAGACAGCATGG + Intergenic
1163772572 19:19199621-19199643 AAGGATTCTGGGGGACCTGAAGG + Intronic
1164598589 19:29546482-29546504 AAGGCTGCTGAGAGAGATAAAGG + Intronic
1165622175 19:37257256-37257278 ATGTCTTCTGGGAGACATAGTGG - Intergenic
1166193942 19:41194087-41194109 AAGGATTCTGGGTGACTTCAAGG + Intronic
925673215 2:6333850-6333872 AAGGCTTGGGGGTGACATTAGGG - Intergenic
925768881 2:7263170-7263192 GTGGCTTCTGGGAGACATCTGGG + Intergenic
927808160 2:26166529-26166551 AAGGCTGCAGGGAGCCATGATGG - Intergenic
929609795 2:43262350-43262372 AATGCTTCTGGCAACCATCATGG + Intronic
929912621 2:46103634-46103656 AAGGCTTCTGGGCAACAGTAGGG - Intronic
930066591 2:47332476-47332498 ATGGCTGCTGGGAGACCTCCAGG + Intergenic
930300947 2:49614898-49614920 ATGACTTCTGGGCAACATCATGG + Intergenic
932135767 2:69227317-69227339 GAGGCTTCTGGGAGCCAGCTGGG + Intronic
932691355 2:73916453-73916475 AATCCTTCTGGGAGATATTAAGG + Intronic
933909526 2:86927632-86927654 AAGGCTTCTGGGAGACATCATGG + Intronic
934023199 2:87975747-87975769 AAGGCTTCTGGGAGACATCATGG - Intergenic
936413355 2:112280658-112280680 AAGGCTTCTGGGAGACATCATGG + Intronic
940197940 2:151116556-151116578 AAGTCTTTTGGGATATATCAAGG - Intergenic
941112005 2:161426493-161426515 ACTGCTTCTGGGAGGCATCTGGG + Intronic
941227850 2:162870340-162870362 AAGTCTGCTGGCAGACATAATGG - Intergenic
941781725 2:169452689-169452711 AAGGCTTCAGTGAGTCATGATGG + Intergenic
942783427 2:179672600-179672622 GAGGCCTTTGGGAGACATCTGGG + Intronic
945831297 2:214789478-214789500 AAGGCTTCAGTGAGCCATGATGG + Intronic
947182465 2:227423624-227423646 AGGGCTTCTTGGAGAGGTCAGGG + Intergenic
947913996 2:233820119-233820141 CAGGCTTCTGGGACACATCGGGG - Intronic
948013015 2:234664928-234664950 CAGGCTTCTGAGAGAAAGCATGG + Intergenic
948095878 2:235333817-235333839 AAGGCTTCTGGGTGAAAAAAGGG + Intergenic
948940873 2:241195687-241195709 AAGTCTGCTGGGAGCCAACAGGG - Exonic
1169731424 20:8789312-8789334 AAGGCTTCAGTGAGCCATGATGG + Intronic
1170226961 20:14001672-14001694 AGGTCTTCTGGGAGGCCTCAGGG + Intronic
1170657155 20:18298571-18298593 ATGGCTTGTGGGAGACATGGTGG + Intronic
1170989072 20:21285664-21285686 CAGGCTTGGGGGAGAAATCAGGG - Intergenic
1172794174 20:37525837-37525859 AAGTCTTCTGGGAGCAATGATGG - Intronic
1173133057 20:40412397-40412419 AAGGATATTGGCAGACATCAGGG + Intergenic
1173398626 20:42704256-42704278 GATGATTTTGGGAGACATCAAGG - Intronic
1174478274 20:50812878-50812900 AAGGCTGCTGTGAGCCATCATGG - Intronic
1175476200 20:59276447-59276469 AGGCAATCTGGGAGACATCATGG + Intergenic
1176164030 20:63663564-63663586 AGGGCTTCTGGGGCTCATCACGG + Intronic
1176300511 21:5096846-5096868 AAGGTTCCTGGGTGACCTCAAGG + Intergenic
1179175127 21:39002778-39002800 AGGCTTTCTGGGAGACGTCATGG + Intergenic
1179856532 21:44165135-44165157 AAGGTTCCTGGGTGACCTCAAGG - Intergenic
1180489264 22:15827096-15827118 AAGGTTTCTGAGGGACTTCAAGG + Intergenic
1181018857 22:20087776-20087798 ATGGCTTCTGGGCCACAGCATGG + Intronic
1181581581 22:23831769-23831791 AAGGCTGCTGGGAGCCCTCACGG + Intronic
1182470893 22:30547566-30547588 GGGACTTCTGGGAGACAGCAGGG + Intergenic
1183238165 22:36635837-36635859 CAGGATTCTGGGAGTCATCCTGG + Intronic
1184193604 22:42911343-42911365 AAGGCTTCAGTGAGCCATGATGG + Intronic
1185134735 22:49063181-49063203 AAGGCCACAGGGAGACACCATGG + Intergenic
949259594 3:2090153-2090175 AAGGCTTCAGTGAGCCATGATGG - Intergenic
951064297 3:18246490-18246512 AAGGATATTGGCAGACATCAAGG - Intronic
951601285 3:24378651-24378673 AAGGCTTCAGGGAGACACATGGG + Intronic
953639392 3:44691933-44691955 AAAACTTCTGGGATACAGCAAGG + Intergenic
954406468 3:50348049-50348071 AGGGCTCCTGAGAGACATAAAGG + Intronic
956088357 3:65637487-65637509 AAGGCTGCAGTGAGACATGATGG + Intronic
958718800 3:97820940-97820962 AGGGCTTCTGGGAGGCAGCGTGG + Intergenic
959236977 3:103736972-103736994 AAGGCTGCTCAGAGTCATCAAGG - Intergenic
959495412 3:107045006-107045028 AAGGCTTCAGGAAGAGATGAGGG + Intergenic
962116471 3:132514375-132514397 AAGGCTTCTTAGAAACCTCAAGG + Intronic
962765505 3:138558690-138558712 ATTGCTTCTGGTAGACATCTAGG - Intronic
964745643 3:160010152-160010174 AAGGCTGCTGTGAGCCATGATGG - Intergenic
966200621 3:177357185-177357207 AATGCTGCTGAGAGACAGCAAGG + Intergenic
966483824 3:180445461-180445483 AAAGCTCCTGGAAGTCATCAGGG - Intergenic
966580919 3:181561871-181561893 AAGGCTGCAGGGAGTTATCAGGG + Intergenic
966933285 3:184689678-184689700 AAGGCCTGTGGGAGACATGCGGG + Intergenic
975530532 4:75395221-75395243 AAGGGTTCTGGAAGACTTCAAGG - Intergenic
976517380 4:85984508-85984530 AAGGCCTTTGGGAGATAACAAGG - Intronic
977369209 4:96113596-96113618 AAGGCTTATGGGGAATATCATGG + Intergenic
977529679 4:98185159-98185181 AAGTCTACTGGAAGACATCTGGG - Intergenic
980849354 4:138361804-138361826 AAGGCTTCTGGTCAACAACAGGG + Intergenic
981875303 4:149535864-149535886 AAAGCCTCTGGGAATCATCATGG - Intergenic
983918132 4:173314351-173314373 AAGGCTGCCAGGAGACAGCATGG - Intronic
985110580 4:186543026-186543048 AAGGCTGCAGGGAGCCATGATGG + Intronic
986027662 5:3865788-3865810 AAGGCTGCAGGGAGCCATGATGG - Intergenic
986116742 5:4782640-4782662 AAGGCTGCAGTGAGACATGATGG - Intergenic
988664598 5:33311540-33311562 AATGCTTCTGGGAAAAATTAAGG - Intergenic
989171355 5:38472730-38472752 AAGGCTTCTCTGAGCCAGCAAGG + Intergenic
990631047 5:57669541-57669563 AAGGCTTCTTGGTGACCGCAAGG + Intergenic
990915602 5:60901233-60901255 AAGGCTTGTAGGAGGGATCAAGG - Intronic
994211868 5:97096051-97096073 AAAGCCTCTGGGAGTCAGCAAGG - Intronic
995534407 5:113120793-113120815 AAAGCAGCTGGGAGACATCAGGG - Intronic
995628036 5:114100706-114100728 AAGGCTTCTTGGAGAAATTATGG + Intergenic
996535905 5:124577572-124577594 AAGGCTTCTGGGAGACATTGGGG - Intergenic
997141663 5:131387797-131387819 AAGGCTGCCTGGAGACAGCAAGG - Intronic
997564360 5:134875559-134875581 AAGGCTGCAGGGAGCCATGATGG - Intronic
997624372 5:135321593-135321615 ATGGCTTCTGAGCAACATCAGGG + Intronic
998249286 5:140540043-140540065 AAGGATTATGGAAGACAACAAGG - Intronic
999866488 5:155705894-155705916 ATGGCACCTGGGAGCCATCAGGG - Intergenic
999921335 5:156324608-156324630 AAGTCTTTGGGGAGACATGAGGG + Intronic
1000407068 5:160899380-160899402 AAGGCTTTTGGGAGACAGGGTGG + Intergenic
1000749418 5:165075161-165075183 GAGGCTGCTGAGAGACCTCATGG + Intergenic
1001759471 5:174195303-174195325 GAGGATCCTGGGAGACACCAGGG - Intronic
1002763925 6:223514-223536 AAGGAGTCTGGGAAACATCCTGG - Intergenic
1003891349 6:10566360-10566382 AAGGCTTCAGTGAGCCATGATGG - Intronic
1005451381 6:25976330-25976352 AAGGCTGCAGGGAGCCATGATGG - Intronic
1006416749 6:33908911-33908933 AAGGTTTCTGGAAGACAACCCGG + Intergenic
1007126409 6:39429455-39429477 AAGGCTCCTGGAAGACAGGAAGG - Intronic
1007255949 6:40528851-40528873 AAGGCTTCTTGGAGAATCCATGG - Intronic
1007380599 6:41488070-41488092 AGGGATTATGGGAGACAGCATGG + Intergenic
1007811597 6:44490216-44490238 CAGCTTTCTGGGAGAGATCAGGG - Intergenic
1007971412 6:46055650-46055672 GATGCTTATGGGAGACATGAGGG - Intronic
1008021459 6:46582843-46582865 TAGGGTTCTGGGAGTTATCATGG - Intronic
1008728764 6:54454070-54454092 AAGGATACTGGATGACATCAAGG + Intergenic
1008957328 6:57230143-57230165 AATGTTTCTGGGAGGAATCAAGG - Intergenic
1009925782 6:70119119-70119141 AAGGGTTCTGGGAGGCAGTAAGG - Intronic
1010201580 6:73286964-73286986 CATGCTTCTGGGAGCCATCCTGG - Intronic
1010319876 6:74494174-74494196 ATGGCTTCTATGAGACAGCAAGG - Intergenic
1010940417 6:81910735-81910757 CAGGCATCTGCAAGACATCAGGG - Intergenic
1012448313 6:99328791-99328813 AAGGCTGGAGGCAGACATCAAGG - Intronic
1012976640 6:105787134-105787156 AAGGCCTCTGGCAGATTTCAAGG + Intergenic
1012994836 6:105963012-105963034 AAGGCTGCAGTGAGCCATCAGGG - Intergenic
1014822343 6:126004814-126004836 AAAGCTTCTGGGAGACTGAAAGG + Intronic
1015274033 6:131366121-131366143 AATGCTTCTGAAAGACATTATGG - Intergenic
1016187422 6:141213971-141213993 AAGTTTTAAGGGAGACATCATGG - Intergenic
1018106995 6:160497772-160497794 AATGTTTCTGGGAGTCATAAGGG - Intergenic
1018223197 6:161602394-161602416 AAGGCTACTGGGAGACAAGCCGG - Intronic
1018449325 6:163892468-163892490 AAGGCCTAGGGGAGAAATCAGGG - Intergenic
1020964077 7:14843753-14843775 AAGCTTTCTGGCAGACAGCAAGG - Intronic
1021340033 7:19453966-19453988 AAAACTTCTGGGATACAGCACGG - Intergenic
1023702163 7:42903540-42903562 AAAGGTTCTGGCAGACAACATGG - Intergenic
1024549996 7:50554884-50554906 AAGTGTTCTGGGAGGCAGCATGG + Intronic
1026552491 7:71380398-71380420 AAGGCTGCTGGGGGCCATGATGG - Intronic
1027638083 7:80701136-80701158 ATGGCTTCAGGAACACATCAAGG + Intergenic
1029204403 7:98860300-98860322 AAGTGTTCTGGGTGACAACAAGG + Exonic
1029973594 7:104813211-104813233 AAGGCTGCAGTGAGACATGATGG + Intronic
1031726537 7:125246916-125246938 CAGGCTTCTGGGAGACAGTATGG + Intergenic
1031868876 7:127070567-127070589 TGAGCTTCTGGGACACATCATGG - Intronic
1031969081 7:128050842-128050864 AAGGGCTCTGGGAGGCAGCAGGG + Intronic
1032213523 7:129938343-129938365 AAGGCTTCAGTGAGCCATGATGG + Intronic
1032803463 7:135334852-135334874 AAGACTTCTGGGAGAGAGAATGG + Intergenic
1032811506 7:135423579-135423601 TAGGGTTCTTGGAGACCTCAGGG - Intronic
1033647690 7:143317793-143317815 AAGGTTTCTTGGAGACAGCGGGG + Intronic
1033650553 7:143339524-143339546 AAGGCTGGTAGGAGAAATCATGG + Exonic
1033702368 7:143853145-143853167 AAGGCTTCAGTGAGCCATGATGG - Exonic
1034657430 7:152740768-152740790 AAGGCTGCTGTGAGCCATGATGG - Intergenic
1035932307 8:3793611-3793633 GAGGCTTCTGGGGGACATTTGGG - Intronic
1037045634 8:14299213-14299235 AAAGCTTCTAGGAGAGAACACGG + Intronic
1037244480 8:16817276-16817298 AAGGCTGCAGGGAGCCATGATGG - Intergenic
1037552473 8:19988251-19988273 GAAGCATCTGAGAGACATCAAGG - Intergenic
1038390100 8:27189505-27189527 AAGGCTGATGGGAGTCCTCAAGG + Intergenic
1038710247 8:29937455-29937477 AAAGCTTCTGGGAGAGAAAAAGG - Intergenic
1039712742 8:40073134-40073156 AATGTTTCTGAGAGATATCAAGG + Intergenic
1040330142 8:46381685-46381707 AAGGACTCAGGGAGACATTAAGG + Intergenic
1045965700 8:108022007-108022029 AAGGCCTATGGAAGTCATCATGG - Intronic
1046071272 8:109257424-109257446 AAGGCTGCTAGGACACATTAAGG + Intronic
1048772144 8:137906209-137906231 AAGGATTCTGGGAGGAGTCAGGG + Intergenic
1048976495 8:139675790-139675812 GAGGCTTCTAGGAGACCTTAAGG - Intronic
1049931740 9:463873-463895 AAGGTGTCTGGGAGAGGTCAAGG - Intronic
1050085246 9:1958577-1958599 AAGGATTCTGAGAAACTTCAGGG + Intergenic
1055813539 9:80179072-80179094 TTGGCTTCTGGGAGAACTCAGGG + Intergenic
1057025213 9:91730019-91730041 AAGGCTGCAGTGAGCCATCATGG - Intronic
1057141243 9:92727904-92727926 AAGGCATGTGGCAGATATCAGGG - Intronic
1058804581 9:108578624-108578646 TAGACTTCTGGGACACCTCAGGG + Intergenic
1059538100 9:115102448-115102470 AAGGCTTCTAGAAGCCTTCAAGG - Intronic
1059966238 9:119617081-119617103 GAGACTTCTGAGAGACACCAAGG + Intergenic
1060155551 9:121317712-121317734 AGGGCCTCTGGGAAACATCTGGG - Intronic
1061160334 9:128890260-128890282 AACGCATCTGGAAGACAGCAGGG - Intronic
1061912287 9:133731577-133731599 AAGGCTTCTGGGAGAAAGTGAGG - Intronic
1185644499 X:1607709-1607731 AAGGCTGCAGGGAGAAATGATGG + Intergenic
1187523258 X:20031926-20031948 AACGGTTCTGGGAGAAATCTGGG + Intronic
1188726378 X:33588812-33588834 AAGAGTTCTGGGAAACAACATGG + Intergenic
1189083108 X:37994949-37994971 GAGGTGTCTGTGAGACATCAAGG + Intronic
1192495684 X:71615502-71615524 AAGGCTTCTTGAAGACTTAAAGG - Intergenic
1192830322 X:74744365-74744387 GAGACCTCTGGGATACATCAGGG + Exonic
1193792393 X:85831517-85831539 AAGGCTTTTGGGAGAGGTGATGG + Intergenic
1195815802 X:108885936-108885958 TAGGCTTCTTGGAGGCCTCAAGG - Intergenic
1198602318 X:138296779-138296801 AATCCTTCTGTGAGACCTCATGG + Intergenic
1198810066 X:140526324-140526346 GAGGGTTCTGTGAGACACCAGGG + Intergenic
1199853940 X:151744601-151744623 GAGGCTTTTGGGAGAATTCAGGG - Exonic