ID: 936419589

View in Genome Browser
Species Human (GRCh38)
Location 2:112350474-112350496
Sequence CTGTGGACCAGTAAAGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936419589_936419597 16 Left 936419589 2:112350474-112350496 CCTTGCTCTTTACTGGTCCACAG No data
Right 936419597 2:112350513-112350535 TGGCATGAAAGGTCTACATGGGG No data
936419589_936419592 -4 Left 936419589 2:112350474-112350496 CCTTGCTCTTTACTGGTCCACAG No data
Right 936419592 2:112350493-112350515 ACAGAACGTTGGACCAACTATGG No data
936419589_936419599 18 Left 936419589 2:112350474-112350496 CCTTGCTCTTTACTGGTCCACAG No data
Right 936419599 2:112350515-112350537 GCATGAAAGGTCTACATGGGGGG No data
936419589_936419595 14 Left 936419589 2:112350474-112350496 CCTTGCTCTTTACTGGTCCACAG No data
Right 936419595 2:112350511-112350533 TATGGCATGAAAGGTCTACATGG No data
936419589_936419598 17 Left 936419589 2:112350474-112350496 CCTTGCTCTTTACTGGTCCACAG No data
Right 936419598 2:112350514-112350536 GGCATGAAAGGTCTACATGGGGG No data
936419589_936419596 15 Left 936419589 2:112350474-112350496 CCTTGCTCTTTACTGGTCCACAG No data
Right 936419596 2:112350512-112350534 ATGGCATGAAAGGTCTACATGGG No data
936419589_936419593 5 Left 936419589 2:112350474-112350496 CCTTGCTCTTTACTGGTCCACAG No data
Right 936419593 2:112350502-112350524 TGGACCAACTATGGCATGAAAGG No data
936419589_936419600 19 Left 936419589 2:112350474-112350496 CCTTGCTCTTTACTGGTCCACAG No data
Right 936419600 2:112350516-112350538 CATGAAAGGTCTACATGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936419589 Original CRISPR CTGTGGACCAGTAAAGAGCA AGG (reversed) Intergenic
No off target data available for this crispr