ID: 936419614

View in Genome Browser
Species Human (GRCh38)
Location 2:112350611-112350633
Sequence CAGTCTGAGGAGAGTCAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936419606_936419614 10 Left 936419606 2:112350578-112350600 CCCTGGATTAAATGGTCCTAGTT No data
Right 936419614 2:112350611-112350633 CAGTCTGAGGAGAGTCAGGCGGG No data
936419608_936419614 -6 Left 936419608 2:112350594-112350616 CCTAGTTTACTAATGCCCAGTCT 0: 18
1: 52
2: 34
3: 38
4: 133
Right 936419614 2:112350611-112350633 CAGTCTGAGGAGAGTCAGGCGGG No data
936419607_936419614 9 Left 936419607 2:112350579-112350601 CCTGGATTAAATGGTCCTAGTTT 0: 13
1: 25
2: 32
3: 36
4: 121
Right 936419614 2:112350611-112350633 CAGTCTGAGGAGAGTCAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936419614 Original CRISPR CAGTCTGAGGAGAGTCAGGC GGG Intergenic
No off target data available for this crispr