ID: 936419762

View in Genome Browser
Species Human (GRCh38)
Location 2:112352589-112352611
Sequence CACTGTGTGTTGGGGGCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936419754_936419762 6 Left 936419754 2:112352560-112352582 CCAGCTGCTTATGCTGATGTTCT No data
Right 936419762 2:112352589-112352611 CACTGTGTGTTGGGGGCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936419762 Original CRISPR CACTGTGTGTTGGGGGCATG GGG Intergenic
No off target data available for this crispr