ID: 936425648

View in Genome Browser
Species Human (GRCh38)
Location 2:112415738-112415760
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58492
Summary {0: 3, 1: 36, 2: 2190, 3: 13578, 4: 42685}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936425648_936425655 30 Left 936425648 2:112415738-112415760 CCAGGTGTGGTGTCGGGCACATG 0: 3
1: 36
2: 2190
3: 13578
4: 42685
Right 936425655 2:112415791-112415813 GAGAATCACTTGAACCCAGGAGG 0: 21628
1: 64917
2: 122797
3: 157734
4: 166761
936425648_936425649 -5 Left 936425648 2:112415738-112415760 CCAGGTGTGGTGTCGGGCACATG 0: 3
1: 36
2: 2190
3: 13578
4: 42685
Right 936425649 2:112415756-112415778 ACATGTAGTCCCACCTATTCAGG 0: 3
1: 49
2: 2063
3: 39903
4: 171753
936425648_936425650 -2 Left 936425648 2:112415738-112415760 CCAGGTGTGGTGTCGGGCACATG 0: 3
1: 36
2: 2190
3: 13578
4: 42685
Right 936425650 2:112415759-112415781 TGTAGTCCCACCTATTCAGGAGG 0: 40
1: 2495
2: 51315
3: 173670
4: 230309
936425648_936425654 27 Left 936425648 2:112415738-112415760 CCAGGTGTGGTGTCGGGCACATG 0: 3
1: 36
2: 2190
3: 13578
4: 42685
Right 936425654 2:112415788-112415810 CAAGAGAATCACTTGAACCCAGG 0: 1769
1: 42452
2: 114404
3: 164204
4: 204515

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936425648 Original CRISPR CATGTGCCCGACACCACACC TGG (reversed) Intronic
Too many off-targets to display for this crispr