ID: 936425651

View in Genome Browser
Species Human (GRCh38)
Location 2:112415765-112415787
Sequence TCTCTGCCTCCTGAATAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149762
Summary {0: 5, 1: 11, 2: 757, 3: 15795, 4: 133194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936425651_936425655 3 Left 936425651 2:112415765-112415787 CCCACCTATTCAGGAGGCAGAGA 0: 5
1: 11
2: 757
3: 15795
4: 133194
Right 936425655 2:112415791-112415813 GAGAATCACTTGAACCCAGGAGG 0: 21628
1: 64917
2: 122797
3: 157734
4: 166761
936425651_936425656 9 Left 936425651 2:112415765-112415787 CCCACCTATTCAGGAGGCAGAGA 0: 5
1: 11
2: 757
3: 15795
4: 133194
Right 936425656 2:112415797-112415819 CACTTGAACCCAGGAGGCAGAGG 0: 9186
1: 33764
2: 74834
3: 112568
4: 133392
936425651_936425654 0 Left 936425651 2:112415765-112415787 CCCACCTATTCAGGAGGCAGAGA 0: 5
1: 11
2: 757
3: 15795
4: 133194
Right 936425654 2:112415788-112415810 CAAGAGAATCACTTGAACCCAGG 0: 1769
1: 42452
2: 114404
3: 164204
4: 204515

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936425651 Original CRISPR TCTCTGCCTCCTGAATAGGT GGG (reversed) Intronic
Too many off-targets to display for this crispr