ID: 936425653

View in Genome Browser
Species Human (GRCh38)
Location 2:112415769-112415791
Sequence CTTGTCTCTGCCTCCTGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1962
Summary {0: 7, 1: 1, 2: 18, 3: 235, 4: 1701}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936425653_936425654 -4 Left 936425653 2:112415769-112415791 CCTATTCAGGAGGCAGAGACAAG 0: 7
1: 1
2: 18
3: 235
4: 1701
Right 936425654 2:112415788-112415810 CAAGAGAATCACTTGAACCCAGG 0: 1769
1: 42452
2: 114404
3: 164204
4: 204515
936425653_936425656 5 Left 936425653 2:112415769-112415791 CCTATTCAGGAGGCAGAGACAAG 0: 7
1: 1
2: 18
3: 235
4: 1701
Right 936425656 2:112415797-112415819 CACTTGAACCCAGGAGGCAGAGG 0: 9186
1: 33764
2: 74834
3: 112568
4: 133392
936425653_936425655 -1 Left 936425653 2:112415769-112415791 CCTATTCAGGAGGCAGAGACAAG 0: 7
1: 1
2: 18
3: 235
4: 1701
Right 936425655 2:112415791-112415813 GAGAATCACTTGAACCCAGGAGG 0: 21628
1: 64917
2: 122797
3: 157734
4: 166761

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936425653 Original CRISPR CTTGTCTCTGCCTCCTGAAT AGG (reversed) Intronic
900011001 1:108363-108385 GTTGCCTCAGCCTCCTGAAGTGG - Intergenic
900027103 1:284927-284949 GTTGCCTCAGCCTCCTGAAGTGG - Intergenic
900033324 1:386916-386938 TTTCTCTCTGCCTCCTCACTTGG - Intergenic
900054162 1:616805-616827 TTTCTCTCTGCCTCCTCACTTGG - Intergenic
900785223 1:4645171-4645193 CCTGACTCAGCCTCCTGAGTAGG + Intergenic
901122229 1:6905303-6905325 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
901178622 1:7323632-7323654 CCTGCCTCAGCCTCCTGAGTCGG + Intronic
901343300 1:8515248-8515270 CCTGGCTCAGCCTCCTGAGTAGG - Intronic
901381336 1:8876935-8876957 CCTGTCTCAGCCTCCCGAGTAGG + Intronic
901402726 1:9025654-9025676 CTTGCCTCTGCCTCTAGAACAGG + Intronic
901449027 1:9325022-9325044 CTGGCTGCTGCCTCCTGAATGGG + Intronic
901496389 1:9624758-9624780 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
901590000 1:10333256-10333278 CCTGTCTCAGCCTCCTGAGTAGG - Intronic
901710818 1:11113722-11113744 CCTGCCTCTGCCTCCTGAGCAGG + Intronic
901854647 1:12036960-12036982 CCCGCCTCAGCCTCCTGAATAGG + Intergenic
902130360 1:14255007-14255029 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
902312342 1:15590722-15590744 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
902369317 1:15995563-15995585 CCTGCCTCAGCCTCCTGATTAGG - Intergenic
902393079 1:16117351-16117373 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
902439433 1:16419826-16419848 CTTGCCTCAGCCTCCCGAGTAGG - Intronic
902522664 1:17029541-17029563 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
902776514 1:18678285-18678307 CCTGTCTCAGCCTCTTGAGTAGG - Intronic
902954394 1:19915085-19915107 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
902973492 1:20071994-20072016 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
903238726 1:21968322-21968344 CATGTCTCTGGCTGCTGAGTGGG - Intergenic
903242651 1:21993986-21994008 CATGTCTCTGGCTGCTGAGTGGG - Intronic
903272836 1:22202328-22202350 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
903288354 1:22291156-22291178 TTTGTGTCTGACTCCAGAATCGG - Intergenic
903390178 1:22958572-22958594 CTTGGCTCTGCTTCCTGAACTGG - Intronic
903411284 1:23145579-23145601 CCTGTCTCAGCCTCCTGAGTAGG + Intronic
903982409 1:27198880-27198902 CCTGCCTCAGCCTCCCGAATAGG + Intergenic
904190413 1:28738554-28738576 CCTGTCTCAGCCTCCCGAGTAGG + Intronic
904214248 1:28906885-28906907 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
904275115 1:29377738-29377760 CTTGCCTCAGCCTCCCGAGTAGG + Intergenic
904324628 1:29720295-29720317 CTGGGCTCTGCCCCCTGGATGGG + Intergenic
904349960 1:29898745-29898767 CCTGCCTCAGCCTCCTGAATAGG - Intergenic
904546986 1:31282785-31282807 CATGTCTCAGCCTCCCGAGTAGG + Intronic
904794398 1:33048351-33048373 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
905063687 1:35161556-35161578 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
905103952 1:35551427-35551449 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
905194730 1:36266990-36267012 CCTGTCTCAGCCTCCCGAGTAGG + Intronic
905433163 1:37939250-37939272 CCTGCCTCAGCCTCCTGAATAGG - Intronic
905847482 1:41244553-41244575 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
905981902 1:42236300-42236322 CCTTCCTCAGCCTCCTGAATAGG + Intronic
906234377 1:44195579-44195601 CTTGCCTCAGCCTCCCGAGTAGG - Intergenic
906331968 1:44893173-44893195 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
906336508 1:44936477-44936499 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
906385099 1:45361219-45361241 CTTGTCTCTGCTTCCTGCAGAGG - Intronic
906396017 1:45465297-45465319 CTTGCCTTAGCCTCCTGAGTAGG - Intronic
906424632 1:45700451-45700473 CTTGCCTCAGCCTCCTGAGTAGG + Intronic
906619764 1:47266468-47266490 CCTGTTTCAGCCTCCTGAGTAGG + Intronic
906802687 1:48751344-48751366 CTTTTGCCTGCCTCCTGATTAGG - Intronic
906966200 1:50459081-50459103 CCTGTTTCGGCCTCCTGAGTAGG + Intronic
906984812 1:50671916-50671938 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
907151572 1:52293265-52293287 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
907542075 1:55224861-55224883 CCTGTCTCAGCCTCCTGAGTAGG - Intergenic
907545786 1:55258794-55258816 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
907631617 1:56088996-56089018 CTTGTCTCAACCTCCTAAAGTGG - Intergenic
908239581 1:62177416-62177438 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
908259652 1:62329750-62329772 CCTGTCTCAGCCTCCCGAGTAGG - Intergenic
908515267 1:64885639-64885661 CCTGTCTCAGCCTCCCGAGTAGG - Intronic
908527982 1:65006467-65006489 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
908767464 1:67567481-67567503 CCTGTCTCAGCCTCCTGAGTAGG + Intergenic
908874227 1:68651907-68651929 CTGTTCTCTGCCTCCTGTCTTGG + Intergenic
909155962 1:72077004-72077026 CCTGCCTCAGCCTCCTGAATAGG + Intronic
909221329 1:72965241-72965263 CCTGCCTCTGCCTCTTGAGTAGG + Intergenic
909614086 1:77587374-77587396 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
909619118 1:77647405-77647427 CATGCCTCAGCCTCCTGAGTAGG - Intronic
909755349 1:79219115-79219137 CATGCCTCAGCCTCCTGAGTAGG - Intergenic
909830432 1:80182331-80182353 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
910175597 1:84427055-84427077 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
910218829 1:84868745-84868767 CTGGTCTCTGCTTCCAGAAGGGG - Intronic
910480649 1:87654822-87654844 CCTCTCTCTGCCTCCTGATCTGG + Intergenic
910564932 1:88632897-88632919 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
910609515 1:89126699-89126721 TTTGCCTCAGCCTTCTGAATAGG + Intronic
910692297 1:89977406-89977428 CGTGCCTCAGCCTCCTGAGTAGG + Intergenic
911113053 1:94212169-94212191 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
911211185 1:95139568-95139590 CCTGCCTCAGCCTCCTGAGTTGG + Intronic
911278750 1:95896995-95897017 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
911498542 1:98659400-98659422 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
912056587 1:105607135-105607157 CCTGTCTCAGCCTCCTGAGTAGG + Intergenic
912990855 1:114484938-114484960 CGTGTCTCAGCCTCCCGAGTAGG - Intronic
913018088 1:114759558-114759580 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
913190837 1:116411619-116411641 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
913374600 1:118136701-118136723 CTTGTCTCTGCTTTCAGAAAGGG + Intronic
913693412 1:121300928-121300950 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
914144144 1:144979152-144979174 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
914226509 1:145723693-145723715 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
914575277 1:148961194-148961216 CTTGCCTCAGCCTCCCGAGTAGG - Intronic
914752813 1:150547367-150547389 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
914835616 1:151204286-151204308 CCTGCCTCTGCCTCCTGAGTAGG + Intronic
914930195 1:151924318-151924340 CCTGCCTCAGTCTCCTGAATAGG + Intergenic
915114896 1:153591201-153591223 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
915133592 1:153713698-153713720 CCTGCCTCTGCCTCCCGAGTAGG + Intergenic
915210275 1:154303561-154303583 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
915222498 1:154386159-154386181 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
915373597 1:155372721-155372743 CCTGCCTCGGCCTCCTGAGTAGG + Intronic
915375262 1:155388829-155388851 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
915590503 1:156867783-156867805 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
915600081 1:156916946-156916968 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
916740643 1:167644365-167644387 CCTGTCTCAGCCTCCTGAGTAGG - Intronic
916762015 1:167825534-167825556 CTCGTCTCAGCCTCCTGAGTAGG - Intronic
916796643 1:168173602-168173624 CTTGCCTCAGCCTCCCGAGTAGG + Intergenic
917239216 1:172929509-172929531 CCTGTCTCAGCCTCCCGAGTAGG + Intergenic
917426440 1:174919336-174919358 CTTGTGTCAGCCACCTGAAGTGG + Intronic
917541298 1:175917139-175917161 CTTGTCTCAGACTCCTGGAAAGG - Intergenic
917940419 1:179914680-179914702 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
918200846 1:182265500-182265522 CCTGCCTCGGCCTCCTGAGTAGG - Intergenic
918278236 1:182975631-182975653 CTTAGCACTGTCTCCTGAATAGG + Intergenic
918334572 1:183495754-183495776 CTTGTCTTAGCCTCCCGAGTAGG - Intronic
918335966 1:183513481-183513503 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
918337603 1:183534753-183534775 CCTGTCTCAGCCTCCCGAAGTGG - Intronic
918384459 1:183991584-183991606 TTTGTCTCTCCCTCCTGAAATGG - Intronic
918495060 1:185126175-185126197 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
918505252 1:185246739-185246761 CCTGCCTCGGCCTCCTGAGTAGG + Intronic
918741280 1:188133460-188133482 CTTGCCTCAGCCTCCTGAGTAGG - Intergenic
919273535 1:195382845-195382867 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
919555335 1:199046025-199046047 CTTGTCTCTGCCTGCTCCCTAGG - Intergenic
919608726 1:199718779-199718801 CTTGCCTCAGCCTCCTGAGTAGG + Intergenic
919704873 1:200666994-200667016 CCTGCCTCAGCCTCCCGAATAGG - Intronic
920000536 1:202795538-202795560 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
920433114 1:205931576-205931598 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
920480735 1:206319297-206319319 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
920888605 1:209959252-209959274 CATGCCTCAGCCTCCTGAGTAGG + Intronic
921153090 1:212417093-212417115 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
921229958 1:213059782-213059804 CTTGCCTCAGCCTCCTGAGTAGG + Intronic
921391962 1:214625324-214625346 CCTGCCTCATCCTCCTGAATAGG + Intronic
921448004 1:215269551-215269573 ACTGTGTCTGTCTCCTGAATGGG - Intergenic
921557437 1:216615797-216615819 CCTGACTCAGCCTCCTGAGTAGG + Intronic
921711907 1:218381365-218381387 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
922001773 1:221485887-221485909 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
922198452 1:223380895-223380917 CCTGCCTCCGCCTCCTGAGTAGG + Intergenic
922255684 1:223891070-223891092 TTTCTCTCTGCCTCCTCACTTGG - Intergenic
922259446 1:223924370-223924392 GTTGCCTCAGCCTCCTGAAGTGG - Intergenic
922308936 1:224369786-224369808 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
922321150 1:224488570-224488592 ACTGCCTCAGCCTCCTGAATAGG + Intronic
922495145 1:226051272-226051294 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
922510378 1:226161248-226161270 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
922517574 1:226219758-226219780 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
922581319 1:226700355-226700377 CCTGTCTCAGCCTCCCGAGTAGG - Intronic
922590882 1:226775256-226775278 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
922911575 1:229222303-229222325 CCTGTCTCAGCCTCCCAAATAGG + Intergenic
923426979 1:233880599-233880621 CTTGACTCTGACTTCTGAAAAGG - Intergenic
923673659 1:236063040-236063062 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
923691488 1:236197830-236197852 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
923740141 1:236647297-236647319 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
923999373 1:239533617-239533639 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
924048582 1:240057836-240057858 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
924074946 1:240324027-240324049 CTTTTGTCTGCCTCCTGTTTGGG + Intronic
924099723 1:240590895-240590917 CCTGTCTCAGCCTCCTGAGTGGG + Intronic
924221332 1:241878383-241878405 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
924222047 1:241887748-241887770 CCTGTCTCAGCCTCCTAAGTAGG + Intronic
924235958 1:241999695-241999717 CTTGCCTCAGCCTCCTGAGTAGG - Intergenic
924340627 1:243027116-243027138 GTTGCCTCAGCCTCCTGAAGTGG - Intergenic
924407713 1:243768721-243768743 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
924581146 1:245324981-245325003 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1062864665 10:841692-841714 GTTGTCTGTGCCAGCTGAATTGG - Intronic
1062884796 10:1008291-1008313 CCCGCCTCAGCCTCCTGAATAGG - Intronic
1063252104 10:4285072-4285094 CCTGCCTCAGCCTCCCGAATAGG + Intergenic
1063291831 10:4757634-4757656 CTGCTCTCTGCCTCCTGTTTAGG - Intergenic
1063347730 10:5326951-5326973 CCTGCCTCTGACTCCTGAGTTGG + Intergenic
1063624202 10:7674119-7674141 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1063686304 10:8240163-8240185 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1063751888 10:8958561-8958583 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1063783219 10:9350366-9350388 CCTGTCTCAGCCTCCTGAGTAGG - Intergenic
1063795831 10:9513032-9513054 CATGTCTCAGCCTCCTGAGTAGG - Intergenic
1063910235 10:10821750-10821772 CTTGCCTCAGCCTCCTGAATAGG + Intergenic
1063971153 10:11382079-11382101 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1063981256 10:11453650-11453672 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1064078124 10:12286661-12286683 TGTGCCTCTGCCTCCTGAGTAGG - Intergenic
1064098494 10:12442367-12442389 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1064138914 10:12773785-12773807 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1064240678 10:13625204-13625226 CCTACCTCAGCCTCCTGAATAGG - Intronic
1064248115 10:13685694-13685716 CCTGCCTCAGCCTCCTGACTGGG - Intronic
1064413924 10:15132537-15132559 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1064557569 10:16562499-16562521 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1064573159 10:16716612-16716634 CTTATCAGTGCCTCCTGAAGAGG - Intronic
1064616414 10:17162729-17162751 TGTGCCTCTGCCTCCTGAGTAGG - Intronic
1064620419 10:17210955-17210977 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1064730649 10:18327534-18327556 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1064882558 10:20072256-20072278 CCTGTCGCCGCCTCCTGAGTAGG - Intronic
1065031396 10:21590043-21590065 TCTGCCTCAGCCTCCTGAATAGG + Intronic
1065556392 10:26919806-26919828 CCTGTCTCAACCTCCTGAGTAGG - Intergenic
1065683438 10:28260658-28260680 CCTGTCTCAGCCTCTTGAGTAGG - Intronic
1065776966 10:29129999-29130021 CCTGTCTCAGCCTCCCGAGTAGG + Intergenic
1065906636 10:30259696-30259718 CCTGCCTCAGCCTCCTGCATAGG + Intergenic
1066130416 10:32387899-32387921 CCTGCCTCGGCCTCCTGAGTAGG + Intergenic
1066230258 10:33425223-33425245 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1066357845 10:34702051-34702073 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1066418466 10:35242585-35242607 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1066560135 10:36661014-36661036 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1066682421 10:37947069-37947091 CCTGACTCAGCCTCCTGAGTAGG + Intergenic
1066735872 10:38478483-38478505 GTTGCCTCAGCCTCCTGAAGTGG + Intergenic
1067074546 10:43168337-43168359 TTTGCCTCAGCCTCCTGAGTAGG - Intronic
1067306892 10:45072577-45072599 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1067372197 10:45695549-45695571 CCTGCCTCAGCCTCCAGAATAGG - Intergenic
1067387582 10:45830595-45830617 CCTGCCTCAGCCTCCAGAATAGG + Intronic
1067418547 10:46126676-46126698 CCTGCCTCAGCCTCCAGAATAGG - Intergenic
1067446693 10:46354018-46354040 CCTGCCTCAGCCTCCAGAATAGG - Intergenic
1067503898 10:46833253-46833275 CCTGCCTCAGCCTCCAGAATAGG - Intergenic
1067623190 10:47904137-47904159 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1067875682 10:50005497-50005519 CCTGCCTCAGCCTCCAGAATAGG - Intronic
1067998112 10:51299315-51299337 CCTTCCTCAGCCTCCTGAATAGG + Intronic
1068048438 10:51917205-51917227 CTTCCCTCAGCCTCCTGAGTAGG - Intronic
1068126630 10:52849425-52849447 CCTGCCTCTGCCTCCTGAGTAGG + Intergenic
1068597263 10:58916562-58916584 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1068825831 10:61437671-61437693 CCTGCCTCAGCCACCTGAATAGG - Intronic
1069005878 10:63316969-63316991 CATGTCTCAGCCTCCCGAGTAGG + Intronic
1069126519 10:64642195-64642217 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1069404706 10:68086714-68086736 CTTGCCTCAGCCTCCTGAGCTGG + Intergenic
1069430172 10:68327560-68327582 CCTGCCTCAGCCTCCTGAGTGGG - Intronic
1069437167 10:68395224-68395246 CCTGTCTCAGCCTCCCGAGTAGG - Intronic
1069457851 10:68567988-68568010 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1069461393 10:68598800-68598822 CCTGTCTCAGCCTCCCGAGTAGG + Intronic
1069630344 10:69893757-69893779 CTTGTCTCTGTCACCTCACTCGG + Intronic
1069951619 10:72022646-72022668 CCTGCCTCAGCCTCCCGAATAGG + Intergenic
1070099115 10:73368183-73368205 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1070134407 10:73679272-73679294 CCTGCCTCAGCCTCCAGAATAGG + Intronic
1070176842 10:73978102-73978124 CCTGCCTCAGCCTCCTGAGTGGG + Intergenic
1070193206 10:74131657-74131679 CCTGCCTCAGCCTTCTGAATAGG + Intronic
1070392500 10:75983764-75983786 CATGTCTCAGCCTCCTCAGTAGG + Intronic
1070585808 10:77765143-77765165 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1070670452 10:78374009-78374031 CCTGCCTCGGCCTCCTGAGTGGG + Intergenic
1070889106 10:79928868-79928890 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1070909225 10:80102964-80102986 CCTTCCTCGGCCTCCTGAATAGG + Intergenic
1071179453 10:82965622-82965644 CATGTGTCAGCCTCCTGAGTAGG - Intronic
1071514853 10:86290539-86290561 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1071635299 10:87247124-87247146 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1071659949 10:87490863-87490885 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1072099484 10:92215858-92215880 CTTGCCTCAGCCTCCCGAGTAGG + Intronic
1072141117 10:92590082-92590104 TGTGCCTCAGCCTCCTGAATAGG - Intergenic
1072210276 10:93239991-93240013 TCTGTCTCAGCCTCCTGAGTAGG + Intergenic
1072315047 10:94194126-94194148 CTTGTATCTGACTCCCTAATAGG - Intronic
1072582487 10:96751400-96751422 CCTGCCTCAGCCTCCCGAATAGG - Intergenic
1072660282 10:97359758-97359780 CAGGTCTCTGCCTCATCAATTGG + Intronic
1072743153 10:97922414-97922436 CTTGCCCCTGCCCCCAGAATGGG + Intronic
1072939959 10:99753519-99753541 CTTACCTCAGCCTCTTGAATAGG + Intronic
1073040263 10:100599342-100599364 CTTGTCTCTGCTTCCTCACCAGG - Intergenic
1073155209 10:101341076-101341098 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1073410202 10:103335472-103335494 TTTGCCTCAGCCTCCCGAATAGG + Intronic
1073414492 10:103369468-103369490 CCTGCCTCAGCCTCCCGAATAGG + Intronic
1073472078 10:103729003-103729025 CCTGTCTCAGCCTCCTGAGTAGG + Intronic
1074390695 10:113055688-113055710 CCTGCCCCAGCCTCCTGAATAGG + Intronic
1074920242 10:118001094-118001116 CTTCCCTCAGCCTCCTGAATAGG - Intergenic
1075145276 10:119877422-119877444 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1075422091 10:122309236-122309258 CTCGCCTCAGCCTCCTGAGTAGG + Intronic
1075431833 10:122390667-122390689 CCTGTCTCAGCCTCCCAAATAGG - Intronic
1075688123 10:124378033-124378055 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1075730762 10:124635202-124635224 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1075758924 10:124840445-124840467 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1075759886 10:124847737-124847759 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1075799382 10:125143364-125143386 CCTTTCTCAGCCTCCTGAGTAGG - Intronic
1075833396 10:125430370-125430392 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1075864897 10:125709497-125709519 CCTGCCTCAGCGTCCTGAATAGG - Intergenic
1076406646 10:130216725-130216747 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1076620553 10:131784762-131784784 CATGTCTCTGACTGCTGAAGTGG + Intergenic
1076772051 10:132671172-132671194 CCTGTCTCTCCCTTCTGATTGGG + Intronic
1077087402 11:760917-760939 CCTGCCTCAGCCTCCTAAATGGG - Intronic
1077294154 11:1816360-1816382 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1077419219 11:2441799-2441821 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1077513305 11:2983872-2983894 CCTGCCTCAGCCTCCTGAATTGG - Intronic
1077525161 11:3059886-3059908 CCTGCCTCAGCCTCCCGAATAGG + Intergenic
1077548920 11:3190794-3190816 CTGGGCTCTGCCCCATGAATAGG - Intergenic
1077607047 11:3619280-3619302 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1077624555 11:3758671-3758693 CCTGTCTCGGCCTCCTGAGTAGG - Intronic
1077999190 11:7479673-7479695 CTTATGTCTGCCTCCAGAACTGG - Intergenic
1078318455 11:10311206-10311228 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1078889593 11:15542531-15542553 CCTGTCTCAGCCTCCAGCATTGG + Intergenic
1079043013 11:17076442-17076464 CCTGCCTCAGCCTCCCGAATAGG - Intronic
1079195865 11:18326408-18326430 CTTGCCTCAGCCTCCCAAATAGG - Intronic
1079202609 11:18388318-18388340 CCTGTCTCAGCCTCCCGAGTAGG - Intergenic
1079250651 11:18784963-18784985 CATGCCTCAGCCTCCTGAGTAGG + Intronic
1079278014 11:19059779-19059801 CATGTCTGTGCCTCGTCAATGGG + Intronic
1079314657 11:19397448-19397470 CTTGTGTCTGCCTCCTGAAAGGG + Intronic
1079664670 11:23089751-23089773 CCTGCCTCAGCCTCCTGAATAGG + Intergenic
1079843651 11:25435720-25435742 CTTGCCTCAGCCTCCAGAGTAGG - Intergenic
1080300399 11:30778094-30778116 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1080536248 11:33224913-33224935 CCTGTCTCAGCCTCCCGAGTAGG + Intergenic
1080888077 11:36384782-36384804 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1081218148 11:40427393-40427415 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1081285094 11:41258387-41258409 CTTCTCTCTGACACTTGAATAGG + Intronic
1081546372 11:44074934-44074956 CTTGCCTCAGCCTCCCGAGTAGG + Intronic
1081906994 11:46676500-46676522 CCTGTCTCTGCCTCCCAAAGTGG + Intergenic
1081944667 11:46979799-46979821 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1081996325 11:47366707-47366729 CCTGACTCAGCCTCCTGAGTAGG - Intronic
1082092875 11:48104160-48104182 CTTGTCTCTGCCTTTTGGATGGG + Intronic
1082105355 11:48215615-48215637 CCTGTCTCAGCCTCCTGAGTAGG + Intergenic
1082217938 11:49597200-49597222 CTTGTCTCTGTCTCTTGAGAAGG + Intergenic
1082724616 11:56720039-56720061 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1082725512 11:56730473-56730495 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1082825592 11:57575642-57575664 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1082857271 11:57819479-57819501 CTTCTCTCTTCCTTCTGGATTGG + Intronic
1083020675 11:59504005-59504027 CTCATCTCTGCCTCTTGGATGGG + Exonic
1083169061 11:60911647-60911669 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1083252193 11:61475577-61475599 CTTGTCCCAGCCTCCAGCATGGG + Intronic
1083672859 11:64308997-64309019 CCTGTCTCAGCCTCTTGAGTGGG - Intronic
1083696454 11:64446317-64446339 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1084047365 11:66577117-66577139 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1084298437 11:68228415-68228437 CTTGCCTCAGCCTCCTGAGTAGG + Intergenic
1084884315 11:72193556-72193578 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1085009887 11:73131415-73131437 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1085227070 11:74931434-74931456 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1085267828 11:75247643-75247665 CTTGCCTCAGCCTCCCGAGTGGG - Intergenic
1085505929 11:77059049-77059071 CCTGCCTCAGCCTCCTGAATAGG - Intergenic
1085558686 11:77449912-77449934 CTTGTCTATGCTTTCAGAATGGG - Intronic
1085603666 11:77878248-77878270 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1085630655 11:78113599-78113621 CCTGTCTCAGCCTCCTGAGTAGG - Intronic
1085906599 11:80771751-80771773 CTTTTCTCTGTCTTCTGATTGGG - Intergenic
1086361030 11:86059648-86059670 CTTGCCTCAGCCTCCTGAGTAGG - Intronic
1086420295 11:86631842-86631864 CCTGCCTCAGCCTCCTGAATAGG + Intronic
1086462042 11:87015712-87015734 CTTGCCTCAGCCTCCCGAGTAGG + Intergenic
1086548422 11:88026449-88026471 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1086893808 11:92289333-92289355 TTTTTCTCAGCATCCTGAATAGG + Intergenic
1087061031 11:93977659-93977681 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1087107197 11:94422823-94422845 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1087182385 11:95152663-95152685 CTTGCCTCAGCCTCCCGAGTAGG - Intergenic
1087566161 11:99861065-99861087 CTGGCCTCAGCCTCCTGAGTAGG + Intronic
1087575310 11:99982750-99982772 CCTGCCTCTGCCTCCCGAGTAGG + Intronic
1088252909 11:107877168-107877190 CTGCTCTCTGCTTCCTGGATGGG + Intronic
1088263581 11:107968965-107968987 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1088295938 11:108294626-108294648 AATGTCTCAGCCTCCTGAAAAGG - Intronic
1088306205 11:108410818-108410840 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1088547419 11:110973855-110973877 CTGCTCTCTGCCTTCTGAACTGG + Intergenic
1088575534 11:111267601-111267623 ATTGTCTCTGCCTTCTAAAGTGG - Intronic
1088717254 11:112559625-112559647 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1088756718 11:112891071-112891093 CTGGTCTCTACCTCTTGACTAGG - Intergenic
1089295749 11:117466587-117466609 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1089335373 11:117719330-117719352 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1089381118 11:118032794-118032816 CGTGCCTCAGCCTCCTGAGTAGG - Intergenic
1089441397 11:118520537-118520559 CTTGCCTCAGCCTGCTGAGTAGG - Intronic
1089450125 11:118588596-118588618 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1089476280 11:118765661-118765683 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1089505681 11:118960657-118960679 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1089597978 11:119594071-119594093 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1089959592 11:122604120-122604142 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1090145052 11:124312627-124312649 CCTGTCTAAGCCTCCTGAGTAGG + Intergenic
1090207072 11:124891323-124891345 CTTGTCTCTGGCCCCTGCAGAGG - Exonic
1090369810 11:126241659-126241681 CCTGTCTCAGCCTCCTGAGTAGG + Intronic
1090370400 11:126247044-126247066 CTTGCCTCAGCCTCCTGTGTAGG - Intronic
1090645345 11:128762842-128762864 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1090702184 11:129306525-129306547 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1091182587 11:133620120-133620142 CTTGTCTCTGTATCCTGTATGGG - Intergenic
1091470063 12:718702-718724 CGTGCCTCAGCCTCCTGACTAGG - Intergenic
1091689538 12:2586290-2586312 CTCGGCACTGCCTCCTGAGTAGG - Intronic
1091733203 12:2897119-2897141 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1091828255 12:3531349-3531371 CTTGGCTCTTCCTCATTAATGGG - Intronic
1092014675 12:5148955-5148977 CTTGTCTTTACCTCTTGACTGGG + Intergenic
1092187208 12:6489433-6489455 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1092244706 12:6857180-6857202 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1092389747 12:8065540-8065562 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1092427501 12:8386374-8386396 CGTGTCTCAGCCTCCCGAGTAGG - Intergenic
1092461760 12:8693506-8693528 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1092500218 12:9038147-9038169 CCAGCCTCAGCCTCCTGAATAGG - Intergenic
1092668919 12:10840028-10840050 CCTGCCTCTGCCTGCTGAGTAGG - Intronic
1092703784 12:11262146-11262168 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1092738358 12:11605430-11605452 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1093139569 12:15492459-15492481 CCTGCCTCAGCCTCCTGATTAGG - Intronic
1093428218 12:19053462-19053484 ATTGTCACTGCTTCCTGAAGTGG + Intergenic
1093432639 12:19101259-19101281 CTTGCCTCAGCCTCCCGAGTAGG - Intergenic
1093631359 12:21413351-21413373 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1093644731 12:21571848-21571870 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1093778354 12:23104258-23104280 CTGGCCTCAGCCTCCTGAGTAGG - Intergenic
1093796621 12:23320758-23320780 CATGCCTCAGCCTCCTGAGTAGG + Intergenic
1093837794 12:23857842-23857864 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1093941446 12:25059461-25059483 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1094137710 12:27146836-27146858 CCTGCCTCTGCCTCCGGAGTAGG + Intergenic
1094293607 12:28879131-28879153 CCTGCCTCAGCCTCCTGAATAGG - Intergenic
1094339741 12:29397909-29397931 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1094370868 12:29736529-29736551 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1094465663 12:30752028-30752050 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1094575361 12:31680009-31680031 CCTGTCTCAGCCTCCTGAGTTGG - Intronic
1094624849 12:32113819-32113841 CCTGCCTCAGCCTCCTGAATAGG + Intronic
1094639121 12:32256162-32256184 CCTGTCTCAGCCTCCTGAGTAGG + Intronic
1094650183 12:32368581-32368603 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1094826840 12:34276046-34276068 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1095290137 12:40468957-40468979 CCTGCCTCAGCCTCCCGAATAGG - Intronic
1095467738 12:42505545-42505567 CCTGTCTCAGCCTCCAGAGTAGG + Intronic
1095755812 12:45766277-45766299 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1095836517 12:46645239-46645261 CCTGTCTCAGCCTCCTGAGTGGG + Intergenic
1095903199 12:47349951-47349973 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1096168428 12:49446013-49446035 TTTGCCTCAGCCTCCTGAGTAGG + Intronic
1096374482 12:51097072-51097094 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1096518446 12:52170977-52170999 CTTGTCTCTGCCTCGGAACTGGG - Exonic
1096707545 12:53431860-53431882 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1097094299 12:56533525-56533547 CATGTCTCAGCCTTCTGAGTAGG + Intronic
1097288817 12:57897038-57897060 CTCGGCTCTGCCTGCTGATTTGG - Intergenic
1097297059 12:57977967-57977989 CTTGCCTCAGCCTCTTGAGTGGG + Intergenic
1097635825 12:62120964-62120986 CCTGCCTCAGCCTCCCGAATAGG + Intronic
1097638026 12:62145641-62145663 CTTCTCTCTTTCTCCTGAATAGG - Intronic
1097645624 12:62233190-62233212 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1097764678 12:63512104-63512126 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1097764825 12:63513649-63513671 CCTGTCTCAGCCTCCTGAGTAGG - Intergenic
1097768290 12:63550700-63550722 CTCACCTCAGCCTCCTGAATAGG - Intergenic
1097784651 12:63745764-63745786 CTCACCTCGGCCTCCTGAATAGG - Intergenic
1097852454 12:64426193-64426215 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1097999508 12:65924684-65924706 CCTGTCTCAGCCTCCTGAGTAGG - Intronic
1098045618 12:66397399-66397421 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1098353800 12:69590826-69590848 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1099005191 12:77227173-77227195 TGTGTCTCAGCCTCCTGAGTCGG + Intergenic
1099105543 12:78491577-78491599 CATGTCTCAGCCTCCCGAGTAGG - Intergenic
1099208001 12:79749857-79749879 CTTGCCTCAGCCTCCTGAGTAGG - Intergenic
1099303488 12:80926815-80926837 CCTGCCTCAGCCTCCCGAATAGG - Intronic
1099650059 12:85415354-85415376 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1099895925 12:88646374-88646396 CTTATCTCAGCCTCCAGAGTAGG - Intergenic
1100078734 12:90822737-90822759 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1100241705 12:92716206-92716228 CTTGTCTCAGCCTCCCGAGTAGG + Intergenic
1100393773 12:94166876-94166898 CCTGTCTCAGCCTCCTAAATAGG + Intronic
1100498550 12:95150718-95150740 TTTGGCTCAGCCTCCTGAATAGG + Intronic
1100544139 12:95585628-95585650 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1100680136 12:96909442-96909464 CTTCTCTCTGCCTCATGCAAAGG - Intronic
1100716192 12:97308375-97308397 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1100983696 12:100185296-100185318 CTTGGCTCTGCTTCCTAAAGGGG + Intergenic
1101099217 12:101375187-101375209 CCTGCCTCAGCCTCCTGAAAAGG - Intronic
1101465144 12:104940805-104940827 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1101647203 12:106642502-106642524 CCTGTCTCAGCCTCCAGAGTAGG - Intronic
1102075054 12:110053078-110053100 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1102243581 12:111341180-111341202 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1102304650 12:111795392-111795414 CCTGTCTCAGCCTCCTGAGTAGG + Intronic
1102306477 12:111808591-111808613 CCTGTCTCAGCCTCCCGAGTAGG - Intronic
1102324631 12:111969504-111969526 CCTGCCTCAGCCTCCCGAATAGG + Intronic
1102476182 12:113190218-113190240 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1102701197 12:114840860-114840882 CTTGCCTCAACCTCCTGAGTAGG + Intergenic
1102948183 12:117008953-117008975 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1102955858 12:117058629-117058651 CTTGCCTCAGCCTCCTGCATTGG - Intronic
1103108190 12:118249718-118249740 ACTGCCTCTGCCTCCTGAGTAGG - Intronic
1103297092 12:119896964-119896986 CCTGCCTCAGCCTCCTGAATAGG + Intergenic
1103380282 12:120488799-120488821 CCTGTCTCAGCCTCCTCAGTAGG - Intronic
1103380977 12:120494386-120494408 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1103467376 12:121152629-121152651 CCTGCCTCAGCCTCCCGAATAGG + Intronic
1103482639 12:121260839-121260861 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1103482958 12:121263078-121263100 CCTGCCTCAGCCTCCTGAAGTGG + Intronic
1103496611 12:121367642-121367664 CCTACCTCAGCCTCCTGAATAGG - Intronic
1103528994 12:121587043-121587065 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1103544270 12:121688619-121688641 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1103668312 12:122589893-122589915 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1103717067 12:122950954-122950976 CCTGTCTCAGCCTCCTGAGTAGG + Intronic
1103745662 12:123121655-123121677 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1103784458 12:123421777-123421799 CCTGCCTCAGCCTCCCGAATAGG + Intronic
1104010152 12:124924597-124924619 CCTGCCTCAGCCTCCTGAGTGGG - Intergenic
1104820404 12:131673895-131673917 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1105039765 12:132953536-132953558 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1105366678 13:19771545-19771567 CATGCCTCAGCCTCCTGAGTAGG + Intronic
1105421435 13:20255916-20255938 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1105483130 13:20798030-20798052 CCTGTCTCAGCCTCCTAAGTAGG - Intronic
1105552762 13:21412855-21412877 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1105556698 13:21453956-21453978 CCCGTCTCAGCCTCCTGAGTAGG + Intronic
1105687893 13:22804249-22804271 CCTGCCTCAGCCTCCCGAATAGG - Intergenic
1105696997 13:22898401-22898423 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1105901388 13:24757433-24757455 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1106273252 13:28175359-28175381 CTTGCCTCAGCCTCCTGAGTAGG + Intronic
1106356845 13:28991478-28991500 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1106468889 13:30037461-30037483 CTTGGCTCTGCCTCCCGCCTGGG + Intergenic
1106597432 13:31158435-31158457 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1106607087 13:31238693-31238715 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1106623427 13:31393890-31393912 CCTGCCTCGGCCTCCTGAGTAGG + Intergenic
1106673948 13:31937226-31937248 CCTGTCTCAGCCTCCTGAGTAGG - Intergenic
1106690611 13:32111382-32111404 CCTGTCTCAGCCTCCCGAGTAGG - Intronic
1107105544 13:36638615-36638637 CTTGCCTCGGCCTCCTGAGTAGG + Intergenic
1107137523 13:36960622-36960644 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1107362118 13:39630508-39630530 CCTGCCTCTGCCTCCTAAAGTGG + Intergenic
1107625837 13:42282885-42282907 CTTGTTTCTTCATCCAGAATAGG + Intronic
1107669322 13:42727731-42727753 CTTGCCTCAGCCTCCTGAGTAGG - Intergenic
1107867424 13:44716419-44716441 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1107916923 13:45161729-45161751 CCTGCCTCAGCCTCCCGAATAGG - Intronic
1107924767 13:45247954-45247976 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1107938036 13:45361489-45361511 CCTGTCTCAGCCTCCAGAGTAGG + Intergenic
1108237667 13:48425604-48425626 CCTACCTCTGCCTCCTGAGTAGG - Intronic
1108366889 13:49724706-49724728 CTCGCCTCTGTCTCCTGAGTAGG + Intronic
1108380478 13:49849541-49849563 CATGCCTCAGCCTCCTGAGTAGG - Intergenic
1108383978 13:49880854-49880876 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1108387474 13:49913306-49913328 CTTGCCTCAGCCTCCCGAGTAGG - Exonic
1108619687 13:52169183-52169205 TCTGCCTCTGCCTCCTGAGTAGG - Intergenic
1108637771 13:52352364-52352386 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1108737570 13:53300493-53300515 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1109146334 13:58784679-58784701 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1109231135 13:59758889-59758911 CCTATCTCAGCCTCCTGAGTAGG + Intronic
1109457932 13:62617602-62617624 CTTGCCTCAGCCTACTGAGTAGG - Intergenic
1110113063 13:71775189-71775211 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1110346231 13:74450856-74450878 CTTGCCTCTGCCCCCTGAGAAGG + Intergenic
1110437575 13:75492521-75492543 CTTGTCTCAGCCTCCAAAGTAGG - Intergenic
1110490246 13:76095363-76095385 CTTGCCTCAGCCTCCCGAGTAGG - Intergenic
1110520444 13:76469878-76469900 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1110568301 13:76978104-76978126 CTCACCTCTGCCTCCTGAGTAGG - Intergenic
1110828705 13:80004675-80004697 CATGCCTCAGCCTCCTGAGTAGG - Intergenic
1111001578 13:82190972-82190994 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1112413403 13:99183602-99183624 CCTGCCTCAGCCTCCTGAGTTGG + Intergenic
1112510882 13:100008123-100008145 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1112530728 13:100200214-100200236 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1112552885 13:100438264-100438286 CCTGCCTCTGCCTTCTGAGTAGG + Intronic
1112839245 13:103555365-103555387 CTTCTCTCTTCCTCCCGAACAGG - Intergenic
1113368461 13:109700481-109700503 CTGGTATTTGCCTCCTGTATTGG - Intergenic
1113740229 13:112707301-112707323 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1113833866 13:113315989-113316011 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1113845724 13:113389734-113389756 CCTGCCTCAGCCTCCTGAATAGG - Intergenic
1113993391 14:16046913-16046935 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1114037390 14:18642830-18642852 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1114121247 14:19672213-19672235 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1114557095 14:23568304-23568326 CTTGCCTCTGCCTCATGCAGGGG + Exonic
1114830887 14:26140190-26140212 CCTGCCTCAGCCTCCTGAATAGG - Intergenic
1115328569 14:32168958-32168980 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1115448900 14:33523666-33523688 CTTGCCTCAGCCTCCAGAATAGG - Intronic
1115461195 14:33662970-33662992 CCTGCCTCAGCCTCCTGAGTGGG + Intronic
1115550334 14:34499391-34499413 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1115626005 14:35192646-35192668 GTTGTCCCTGCCTCCTCAAGGGG - Intronic
1115683821 14:35772165-35772187 CTCGTCTCAGCCTCCCAAATAGG + Intronic
1115997503 14:39209844-39209866 CGTGCCTCAGCCTCCTGAGTAGG + Intergenic
1116048523 14:39775160-39775182 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1116109008 14:40551163-40551185 CCTGCCTCAGCCTCCCGAATAGG - Intergenic
1116181284 14:41540124-41540146 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1116663361 14:47741967-47741989 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1116741525 14:48761179-48761201 TCTGCCTCTGCCTCCTGAGTAGG + Intergenic
1116827113 14:49683288-49683310 CTTGTCTCAGCCTCACGAGTAGG - Intronic
1117067084 14:52021838-52021860 CTTGGCTCTGCCTCTTCAACAGG + Intronic
1117090911 14:52248960-52248982 CGTGCCTCAGCCTCCTGAGTAGG - Intergenic
1117343724 14:54813026-54813048 CTTGTCATTACCTCCTTAATAGG - Intergenic
1117346266 14:54836029-54836051 CCTGCCTCGGCCTCCTGAGTAGG + Intergenic
1117383349 14:55187428-55187450 CCTGCCTCGGCCTCCTGAGTAGG + Intronic
1117566078 14:56994870-56994892 CCTGTCTCTGCCTCCTGAGTAGG - Intergenic
1117569912 14:57037123-57037145 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1117589020 14:57245936-57245958 CCTGTCTCAGCCTCCCGAGTAGG - Intronic
1117848098 14:59935180-59935202 CCTGCTTCAGCCTCCTGAATAGG - Intronic
1118172864 14:63406297-63406319 TCTGTCTCAGTCTCCTGAATAGG - Intronic
1118183941 14:63521549-63521571 CCTGCCTCAGCCTCCTGAGTGGG - Intronic
1118267360 14:64307644-64307666 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1118356609 14:65019059-65019081 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1118403848 14:65404281-65404303 CCTGTCTCAGCCTCCTGAGTAGG + Intergenic
1118825914 14:69381167-69381189 CTTGCCTCAGCCTCCTGAGTAGG - Intronic
1118825971 14:69381798-69381820 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1118928732 14:70219739-70219761 CCCGTCTCAGCCTCCTGAGTAGG + Intergenic
1119054202 14:71402458-71402480 CTTGCCTCAGCCTCCTGAGTAGG + Intronic
1119258051 14:73216645-73216667 CCTGTCTCAGCCTCCTGAGTAGG - Intronic
1119279648 14:73394518-73394540 CTGGCCTATGCCTCCTGAGTAGG + Intronic
1119466404 14:74862311-74862333 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1119623362 14:76150282-76150304 CTTGCCTTAGCCTCCTGAGTAGG + Intergenic
1119641896 14:76321773-76321795 CCTGCCTCAGCCTCCCGAATGGG - Intronic
1119896733 14:78226113-78226135 CCTGCCTCAGCCTCCTGATTAGG + Intergenic
1120087906 14:80296222-80296244 CGTGCCTCAGCCTCCTGAGTAGG - Intronic
1120111266 14:80560311-80560333 CCTGTCTCAGCCTCCTGAGTAGG - Intronic
1120120709 14:80677395-80677417 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1120787340 14:88549872-88549894 CCTGTCTCAGCCTCCCGAGTAGG + Intronic
1120895115 14:89523872-89523894 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1121054759 14:90843558-90843580 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1121082869 14:91122712-91122734 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1121314703 14:92954003-92954025 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1122342329 14:101036661-101036683 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1122490947 14:102115853-102115875 CCTGCCTCAGCCTCCTGAGTGGG + Intronic
1122604419 14:102938738-102938760 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1123003603 14:105310416-105310438 CCTGCCTCAGCCTCCTGAGTAGG - Exonic
1202833234 14_GL000009v2_random:58735-58757 CTTTTCTCTTCCTCCTGGCTTGG + Intergenic
1123437894 15:20269025-20269047 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1123473232 15:20569888-20569910 CGTGCCTCAGCCTCCTGAGTAGG - Intergenic
1123502875 15:20906773-20906795 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1123560123 15:21480435-21480457 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1123596363 15:21917739-21917761 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1123644776 15:22430465-22430487 CGTGCCTCAGCCTCCTGAGTAGG + Intergenic
1123733532 15:23164899-23164921 CGTGCCTCAGCCTCCTGAGTAGG - Intergenic
1123751664 15:23362274-23362296 CGTGCCTCAGCCTCCTGAGTAGG - Intronic
1123887428 15:24740503-24740525 CCCGCCTCAGCCTCCTGAATAGG + Intergenic
1123891097 15:24780367-24780389 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1123914091 15:25004338-25004360 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1123953454 15:25308576-25308598 CTTATCTCTGCCTTTTGACTGGG + Intergenic
1124087860 15:26568607-26568629 CTTGCCTCAGCCTCCCGAGTAGG + Intronic
1124284037 15:28386199-28386221 CGTGCCTCAGCCTCCTGAGTAGG - Intronic
1124298660 15:28525415-28525437 CGTGCCTCAGCCTCCTGAGTAGG + Intronic
1124389010 15:29236535-29236557 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1124533760 15:30526591-30526613 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1124618600 15:31261103-31261125 CATGCCTCAGCCTCCTGAGTCGG + Intergenic
1124764895 15:32481053-32481075 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1124831832 15:33156390-33156412 CCTGCCTCAGCCTCCCGAATAGG + Intronic
1124921461 15:34030726-34030748 CCTGCCTCGGCCTCCTGAGTAGG + Intronic
1124948611 15:34294342-34294364 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1125569668 15:40706588-40706610 CCTGCCTCTGCCTCCCGAGTAGG - Intronic
1125611484 15:40974228-40974250 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1126020483 15:44395726-44395748 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1126470485 15:49005216-49005238 CTTGCTTCAGCCTCCTGAGTAGG - Intronic
1126485097 15:49171192-49171214 CCTGTCTCAGCCTCCTGAGTAGG + Intronic
1126601404 15:50431766-50431788 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1126602506 15:50443148-50443170 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1126662925 15:51049686-51049708 ATTGACTCTGCATCCTCAATGGG + Intergenic
1126838512 15:52692769-52692791 CCTGTCTCTGCCTCCTGAGTAGG + Intronic
1127115217 15:55719946-55719968 CTTGCCTCAGCCTCCTGAGTAGG - Intronic
1127118255 15:55748146-55748168 CTTGTCTCAGCCTCCCGAGTGGG - Intergenic
1127506774 15:59605645-59605667 CCTTTCTCAGCCTCCTGAGTAGG + Intronic
1127613332 15:60658190-60658212 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1127838793 15:62812127-62812149 GTGGCCTCTGCCTCCTAAATGGG + Intronic
1127929083 15:63578498-63578520 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1127991057 15:64117678-64117700 CCTGCCTCAGCCTCCTGAATAGG - Intronic
1127991261 15:64119610-64119632 CTGGCCTCAGCCTCCTGAGTAGG - Intronic
1128030001 15:64471693-64471715 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1128169863 15:65501999-65502021 CATGCCTCAGCCTCCTGAGTAGG + Intronic
1128274752 15:66343884-66343906 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1128475473 15:67993560-67993582 CTTGCCTCAGCCTCCTAAAATGG + Intergenic
1128939304 15:71774663-71774685 CCTGCCTCTGCGTCCTGAGTAGG - Intronic
1129123493 15:73418200-73418222 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1129165400 15:73774411-73774433 CTTGACTCTGCCTCCTGTATTGG + Intergenic
1129338502 15:74869040-74869062 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1129441310 15:75582811-75582833 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1129555398 15:76502923-76502945 CTTATCTCTGCCTCTTGTTTAGG - Intronic
1129764633 15:78154615-78154637 CTTGCCTCAGCCTCCTGAGTAGG - Intronic
1129875395 15:78972205-78972227 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1129882216 15:79014803-79014825 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1130018210 15:80203409-80203431 CATGTCTCTGCCTCCTGTAGTGG + Intergenic
1130234200 15:82118989-82119011 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1130931425 15:88431031-88431053 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1131085759 15:89574674-89574696 CCTGCCTCAGCCTCCTGAATAGG - Intergenic
1131128797 15:89880560-89880582 CCTGCTTCAGCCTCCTGAATAGG - Intronic
1131322371 15:91406736-91406758 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1131631528 15:94181937-94181959 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1131894864 15:97015978-97016000 CTCACCTCAGCCTCCTGAATAGG + Intergenic
1131903791 15:97118235-97118257 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1132027070 15:98412638-98412660 CGTGCCTCAGCCTCCTGAGTAGG - Intergenic
1132126580 15:99231902-99231924 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1132432789 15:101774472-101774494 CATGCCTCAGCCTCCTGAGTAGG + Intergenic
1202968470 15_KI270727v1_random:207599-207621 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1132493259 16:246388-246410 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1132614641 16:834173-834195 CTTGCCTCAGCCTCCCGAGTAGG - Intergenic
1133190356 16:4129254-4129276 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1133259945 16:4542251-4542273 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1133657578 16:7880969-7880991 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1133882136 16:9792332-9792354 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1133954702 16:10431933-10431955 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1134107042 16:11492671-11492693 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1134125847 16:11615423-11615445 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1134322835 16:13179205-13179227 CCCGCCTCAGCCTCCTGAATAGG - Intronic
1134788250 16:16964305-16964327 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1134824996 16:17277499-17277521 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1134865823 16:17605762-17605784 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1135433926 16:22412115-22412137 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1135478519 16:22800016-22800038 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1135554578 16:23425196-23425218 CCTGCCTCTGCTTCCCGAATAGG - Intronic
1135732682 16:24907772-24907794 CCTGCCTCAGCCTCCCGAATAGG - Intronic
1135811210 16:25588343-25588365 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1135816972 16:25643507-25643529 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1135948784 16:26892560-26892582 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1135981666 16:27152552-27152574 CTTTTCTCTGCCTCCTGCCATGG - Intergenic
1136047916 16:27629899-27629921 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1136224224 16:28847705-28847727 CCTGCCTCGGCCTCCTGAGTAGG - Intronic
1136420011 16:30125986-30126008 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1136461678 16:30415067-30415089 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1136526050 16:30831491-30831513 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1136688822 16:32013010-32013032 CTTGCCTCAGCCTCCTGAGTAGG - Intergenic
1136789414 16:32956525-32956547 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1136846680 16:33581827-33581849 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1136880398 16:33897411-33897433 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1137022375 16:35441433-35441455 ATTCTCTCTGGCTCCTGAAAGGG + Intergenic
1137043395 16:35635433-35635455 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1137278070 16:46950513-46950535 CTTGCCTCAGCCTCCTGTGTTGG + Intergenic
1137298756 16:47125455-47125477 CCTGCCTCAGCCTCCTGAGTGGG + Intronic
1137568457 16:49549203-49549225 CTTGGCTTTGCCTGGTGAATGGG + Intronic
1137639445 16:50015406-50015428 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1137680008 16:50333531-50333553 CTTTTCTCTACCTACTGATTTGG - Intronic
1138141389 16:54571622-54571644 CTTTGCTCTGCCACATGAATTGG - Intergenic
1138185294 16:54972238-54972260 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1138219836 16:55241268-55241290 CCTGCCTCTGCCTCCTGAGTAGG + Intergenic
1138362207 16:56440848-56440870 CCTGTCTCAGCCTCCGGAGTAGG + Intronic
1138366869 16:56486872-56486894 CCTGCCTCAGCCTCCTGAATAGG + Intronic
1138642876 16:58399200-58399222 CTTGCCTCAGTCTCCTGAGTAGG - Intronic
1138644338 16:58412770-58412792 CCTGCCTCAGCCTCCTGAATAGG + Intergenic
1138777091 16:59736006-59736028 CCTGCCTCATCCTCCTGAATAGG - Intronic
1138844421 16:60547952-60547974 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1138899904 16:61256400-61256422 CTTGCCTCAGCCTCCCGAGTAGG + Intergenic
1139088264 16:63615565-63615587 CATGCCTCAGCCTCCCGAATAGG + Intergenic
1139575414 16:67838813-67838835 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1139638467 16:68273874-68273896 CCTGCCTCAGCCTCCTGAGTGGG + Exonic
1139746542 16:69079216-69079238 CTTGCCTCAGCCTCCGGAGTAGG - Intronic
1139780273 16:69345569-69345591 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1139892332 16:70261484-70261506 CCTGCCTCTGCCTCCTGAGTAGG - Intronic
1140335919 16:74105024-74105046 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1140397229 16:74638024-74638046 CTTAACTCTGCCACCTGGATGGG - Intronic
1140561038 16:75982273-75982295 CCTGTCTCAGCCTCCCGAGTAGG + Intergenic
1140568602 16:76074556-76074578 CCTGCCTCTGCCTCCTAAGTAGG + Intergenic
1140774768 16:78239644-78239666 CCTGTCTCAGTCTCCTGAGTAGG + Intronic
1140784050 16:78323216-78323238 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1141041101 16:80673206-80673228 CCTGCCTCTGCCTCCTGAGTAGG - Intronic
1141184310 16:81776218-81776240 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1141189036 16:81810101-81810123 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1141290103 16:82710418-82710440 CCTGTCTCAGCCTCCCGAGTAGG - Intronic
1141490889 16:84371910-84371932 CCTGTCTCTGCCTCCTGGTTGGG - Intronic
1141522155 16:84587881-84587903 CCTGTCTCAGCCTCCTGAGTAGG + Intronic
1141598319 16:85110814-85110836 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1141779289 16:86148509-86148531 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1142453345 16:90198553-90198575 GTTGCCTCAGCCTCCTGAAGTGG + Intergenic
1203091615 16_KI270728v1_random:1218013-1218035 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1203108388 16_KI270728v1_random:1430482-1430504 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1142618305 17:1149527-1149549 CCTGTCTCAGCCTCCCGAGTAGG + Intronic
1142725326 17:1809779-1809801 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1142725770 17:1812658-1812680 CCTGCCTCAGCCTCCTGAATAGG + Intronic
1142727228 17:1824729-1824751 CCTGTCTCAGCCTCCTGAGTAGG + Intronic
1142761416 17:2044124-2044146 TCTGTCTCAGCCTCCTGAGTAGG + Intergenic
1142899207 17:3002072-3002094 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1143034803 17:3988576-3988598 CCTGCCTCAGCCTCCTGAATAGG + Intergenic
1143047893 17:4097147-4097169 CCTGTCTCAGCCTCCCGAGTAGG - Intronic
1143149606 17:4799524-4799546 CTTGTCTCAGCCTCCCAAGTAGG + Intergenic
1143206162 17:5140459-5140481 CCTGCCTCAGCCTCCTGACTAGG - Intronic
1143214673 17:5215500-5215522 CCTGCCTCAGCCTCCCGAATAGG - Intronic
1143261556 17:5602941-5602963 CCTGCCTCAGCCTCCTGACTGGG + Intronic
1143435577 17:6922052-6922074 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1143489491 17:7277028-7277050 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1143642819 17:8209130-8209152 CCTGCCTCGGCCTCCTGAGTAGG + Intronic
1143674720 17:8423570-8423592 CCTGCCTCAGCCTCCTGAATAGG - Intronic
1143786627 17:9260510-9260532 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1144000419 17:11049047-11049069 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1144033288 17:11341444-11341466 CTTGCCTCAGCCTCCTGAGTTGG + Intronic
1144036928 17:11375670-11375692 CTTGAATCTGCCTCCTGCCTGGG + Intronic
1144128268 17:12222206-12222228 CTTGTCACTGTGTCCAGAATTGG - Intergenic
1144562897 17:16336343-16336365 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1144691925 17:17272309-17272331 CCTGTCTCAGCCTCCCAAATAGG - Intronic
1144797764 17:17904077-17904099 CCTGCCTCAGCCTTCTGAATAGG + Intronic
1144896996 17:18545730-18545752 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1145048957 17:19644335-19644357 CCTGTGTCAGCCTCCTGAATAGG - Intergenic
1145061121 17:19734644-19734666 CTTGCCTCAGCCTCCTAAGTTGG + Intergenic
1145197564 17:20908173-20908195 CGTGTCTCAGCCTCCCGAGTAGG - Intergenic
1145710686 17:26971458-26971480 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1145928900 17:28669822-28669844 CTTGCCTCAGCCTCCCGAGTAGG - Intronic
1145932136 17:28693347-28693369 CGTGCCTCAGCCTCCTGAGTAGG - Intronic
1145977817 17:28994385-28994407 CTTGCCTCAGCCTCCCGAGTAGG + Intronic
1145984985 17:29039836-29039858 CTTGCCTCAGCCACCTGAGTAGG + Intronic
1146134821 17:30310094-30310116 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1146177529 17:30675644-30675666 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1146304133 17:31717496-31717518 CTTGCCTCAGCCTCCTAAGTAGG + Intergenic
1146326238 17:31888581-31888603 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1146373558 17:32280151-32280173 CTGGAAGCTGCCTCCTGAATAGG - Intronic
1146769441 17:35555258-35555280 CCTGCCTCAGCCTCCCGAATAGG - Intronic
1146842448 17:36165369-36165391 CCTGCCTCAGCCTCCTGACTAGG + Intergenic
1146854758 17:36253328-36253350 CCTGCCTCAGCCTCCTGACTAGG + Intronic
1146865862 17:36335048-36335070 CCTGCCTCAGCCTCCTGACTAGG - Intronic
1146870658 17:36377220-36377242 CCTGCCTCAGCCTCCTGACTAGG + Intronic
1146878016 17:36428301-36428323 CCTGCCTCAGCCTCCTGACTAGG + Intronic
1146881957 17:36449405-36449427 CCTGCCTCAGCCTCCTGACTAGG + Intergenic
1146940456 17:36840499-36840521 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1146987863 17:37238936-37238958 CTTGTTTCAGCCTCTTGAGTAGG + Intronic
1147002209 17:37371786-37371808 CCTGCCTCAGCCTCCCGAATAGG - Intronic
1147002682 17:37375373-37375395 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1147068732 17:37935660-37935682 CCTGCCTCAGCCTCCTGACTAGG - Intergenic
1147073541 17:37977844-37977866 CCTGCCTCAGCCTCCTGACTAGG + Intergenic
1147080255 17:38015197-38015219 CCTGCCTCAGCCTCCTGACTAGG - Intronic
1147085063 17:38057382-38057404 CCTGCCTCAGCCTCCTGACTAGG + Intronic
1147096203 17:38139157-38139179 CCTGCCTCAGCCTCCTGACTAGG - Intergenic
1147101009 17:38181348-38181370 CCTGCCTCAGCCTCCTGACTAGG + Intergenic
1147118606 17:38321577-38321599 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1147151674 17:38519181-38519203 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1147221887 17:38939179-38939201 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1147223566 17:38956022-38956044 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1147405158 17:40206182-40206204 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1147451188 17:40505588-40505610 CTTGCTTCAGCCTCCTGAGTAGG + Intergenic
1147675857 17:42205137-42205159 CTTGCCTCAGCCTCCTGAGTAGG + Intronic
1147816928 17:43217010-43217032 GTTTTGTCTGTCTCCTGAATGGG + Intronic
1147817338 17:43219618-43219640 CCTGCCTCAGCCTCCTGAGTAGG - Exonic
1147940291 17:44042173-44042195 CCTGTCTCAGCCTCCTGAGTAGG - Intronic
1147972828 17:44228967-44228989 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1147992404 17:44342970-44342992 CCTGCCTCGGCCTCCTGAGTAGG + Intergenic
1148014904 17:44514713-44514735 CCTGTCTCAGCCTCCCGAGTAGG + Intergenic
1148039369 17:44694253-44694275 CTTGCCTCAACCTCCTGAGTAGG - Intergenic
1148117683 17:45186658-45186680 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1148202884 17:45761503-45761525 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1148247304 17:46042017-46042039 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1148282195 17:46357059-46357081 CATGCCTCAGCCTCCTGAGTAGG - Intronic
1148304413 17:46574982-46575004 CATGCCTCAGCCTCCTGAGTAGG - Intronic
1148346352 17:46906002-46906024 CTTCTCCCTTCCTCCTGAAGAGG + Intergenic
1148410488 17:47462339-47462361 CCTGCCCCAGCCTCCTGAATAGG - Intergenic
1148493847 17:48040181-48040203 CCTGTCTCAGTCTCCTGAGTAGG + Intergenic
1148840245 17:50490948-50490970 CTTGCCTCAGCCTCCAGAGTAGG + Intergenic
1149078063 17:52620060-52620082 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1149096591 17:52848431-52848453 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1149470439 17:56911778-56911800 CTTGCCTCAGCCTCCTGAGTAGG - Intronic
1149796817 17:59528663-59528685 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1149845600 17:60007811-60007833 CCTGCCTCAGCCTCCTGACTAGG + Intergenic
1149898586 17:60451583-60451605 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1149935707 17:60804367-60804389 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1150040715 17:61857610-61857632 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1150047799 17:61930556-61930578 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1150074787 17:62183181-62183203 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1150083949 17:62264394-62264416 CCTGCCTCAGCCTCCTGACTAGG + Intergenic
1150322672 17:64229283-64229305 CTTTTCCCTGCCCACTGAATGGG - Intronic
1150497420 17:65618827-65618849 CCTGCCTCAGCCTCCTGAAGTGG - Intronic
1150545556 17:66154065-66154087 CCTGCCTCAGCCTCCTGAATAGG - Intronic
1150606888 17:66699696-66699718 CCTGCCTCAGCCTCCTGAATAGG + Intronic
1150755493 17:67908602-67908624 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1150909577 17:69374068-69374090 CCTGCCTCTGCCTCCCGAGTAGG - Intergenic
1151004114 17:70413724-70413746 CCTGGCTCAGCCTCCTGAGTAGG + Intergenic
1151065387 17:71143349-71143371 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1151170403 17:72241095-72241117 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1151247328 17:72804902-72804924 CCTGCCTCAGCCTCCCGAATGGG - Intronic
1151279186 17:73059541-73059563 CCTGTCTCAGCCTCCTGAGGTGG - Intronic
1151442480 17:74139957-74139979 CCTGCCTCAGCCTCCCGAATAGG - Intergenic
1151513247 17:74575232-74575254 CCTGCCTCAGCCTCCTGACTAGG - Intergenic
1151523204 17:74645875-74645897 CTTGCCTCAGCCTCCCGAGTAGG - Intergenic
1151576992 17:74957786-74957808 CATGCCTCAGCCTCCTGAGTAGG - Intronic
1151581763 17:74983180-74983202 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1151611383 17:75177875-75177897 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1151638250 17:75368325-75368347 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1152347381 17:79761415-79761437 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1152452509 17:80390948-80390970 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1152680203 17:81663974-81663996 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1152787541 17:82257069-82257091 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1152849711 17:82625992-82626014 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1153028854 18:694514-694536 CTTGCCTCAGCCTCCTGAGTAGG - Intronic
1153033971 18:741353-741375 CATGCCTCAGCCTCCTGAGTAGG + Intronic
1153216562 18:2826277-2826299 CTTGCCTCAGCCTCCTGAGAAGG + Intergenic
1153311681 18:3682966-3682988 CCTGTCTCAGCCTCTTGAGTAGG + Intronic
1153630807 18:7067963-7067985 CCTGGCTCAGCCTCCTGAGTAGG + Intronic
1153657014 18:7291667-7291689 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1153687084 18:7557296-7557318 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1153716651 18:7856630-7856652 CTTGCCTCAGCCTCCAGAGTAGG - Intronic
1153731480 18:8017469-8017491 CTTGCCTCAGCCTCCTGAGTAGG - Intronic
1153847770 18:9065166-9065188 CCTGTGTCAGCCTCCTGAGTAGG - Intergenic
1154042125 18:10866395-10866417 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1154123931 18:11673112-11673134 CTTGTATCAACCTCCTGACTTGG + Intergenic
1154343113 18:13520739-13520761 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1154408236 18:14116897-14116919 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1154947033 18:21172249-21172271 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1154990892 18:21597411-21597433 CTTGCCTCAGCCTCCCAAATAGG - Intronic
1155030551 18:21980028-21980050 CCTGCCTCAGCCTCCTGAAAAGG - Intergenic
1155033069 18:22001273-22001295 CTTGACCCAGCCTCCTGAGTAGG + Intergenic
1155151074 18:23123343-23123365 CTTGCCTCAGTCTCCTGAGTAGG - Intergenic
1155472252 18:26203413-26203435 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1155948009 18:31877498-31877520 CTTGCCTCAGCCTCCCGAGTAGG - Intronic
1155958349 18:31973072-31973094 CCTGTCTCAGCCTCCAGAGTAGG - Intergenic
1156059737 18:33059613-33059635 TTTGTCTTTACCTCCTAAATAGG + Intronic
1156209724 18:34926297-34926319 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1156219820 18:35040089-35040111 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1156449113 18:37256694-37256716 CCTGCCTCTACCTCCTGAGTAGG + Intronic
1156598397 18:38574876-38574898 CCTGTCTCAGCCTCCCGAGTAGG + Intergenic
1156994876 18:43452983-43453005 CCTGCCTCAGCCTCCTGAATGGG + Intergenic
1157019760 18:43766529-43766551 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1157259282 18:46164720-46164742 CCTGTCTCTCACTCCTGACTTGG - Intergenic
1158049907 18:53204433-53204455 CCTGTCTCAGCTTCCTGAATAGG - Intronic
1158622484 18:59045193-59045215 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1158716802 18:59887877-59887899 CTTGCCTCAGCCTCCTAAGTAGG + Intergenic
1158908147 18:62034322-62034344 CTTGCCTCAGCCTCCTGTGTTGG + Intergenic
1159056352 18:63468663-63468685 CCGGTCTCTGCCTCCTAAAATGG - Intergenic
1159144806 18:64440854-64440876 CCTGGCTCAGCCTCCTGAGTAGG + Intergenic
1159628824 18:70726014-70726036 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1159708200 18:71718862-71718884 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1159710119 18:71748234-71748256 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1159780360 18:72654018-72654040 CTTGCCTCGGCCTCCCGAGTAGG + Intergenic
1160027678 18:75231747-75231769 CTGGTCTCTAACTCCTGACTTGG + Intronic
1160375988 18:78412292-78412314 CCTACCTCAGCCTCCTGAATAGG - Intergenic
1160736750 19:666288-666310 TCTGTCTCAGCCTCCTGAGTAGG - Intergenic
1160833696 19:1114744-1114766 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1161006379 19:1939136-1939158 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1161158605 19:2748766-2748788 CATGTCTCAGCCTCCAGAGTAGG - Intergenic
1161437960 19:4275053-4275075 CCTATCTCTGCCTCCTGAGTAGG + Intergenic
1161539049 19:4838690-4838712 CTTGCCTCAGCCTCCTAACTGGG + Exonic
1161599633 19:5173674-5173696 CGTGCCTCGGCCTCCTGAGTAGG - Intronic
1161665771 19:5575385-5575407 CTTGCCTCAGCCTCCCGAGTAGG - Intergenic
1161739146 19:6009691-6009713 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1161889958 19:7027809-7027831 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1161891494 19:7042937-7042959 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1161893579 19:7061394-7061416 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1161986918 19:7660535-7660557 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1162174242 19:8819290-8819312 CTTGCCTCAGCCTCCCGAGTAGG + Intronic
1162210237 19:9085543-9085565 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1162253122 19:9463792-9463814 CCTATCTCAGCCTCCTGAGTAGG + Intergenic
1162259496 19:9520930-9520952 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1162312983 19:9918300-9918322 CCTACCTCAGCCTCCTGAATAGG + Intronic
1162385283 19:10357275-10357297 CCTGTCTCAGCCTCCCGAGTAGG - Intronic
1162404542 19:10465810-10465832 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1162556555 19:11390103-11390125 CCTGTCTCAGCCTCTTGAGTAGG - Intronic
1162651932 19:12095098-12095120 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1162662518 19:12181582-12181604 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1162743205 19:12784804-12784826 CTTGTCTCTATCTTCTGAGTTGG - Intronic
1162993189 19:14316870-14316892 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1163090348 19:15015073-15015095 CCTCCCTCAGCCTCCTGAATAGG - Intronic
1163172905 19:15544947-15544969 CCTGTCTCAGCCTCCCGAGTAGG - Intronic
1163173045 19:15546084-15546106 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1163231925 19:16009544-16009566 CTTGCCTCAGCCTCCTGGGTAGG + Intergenic
1163244291 19:16083330-16083352 CTTGCCTTAGCCTCCTGAGTAGG - Intronic
1163509991 19:17728665-17728687 CCTGTCTCAGCCTCCCGAGTAGG + Intronic
1163552170 19:17971572-17971594 CCTGTCTCAACCTCCTGAGTAGG + Intronic
1163728867 19:18938590-18938612 CTAGTCTCTATCTCCTGAAAGGG - Intronic
1163809380 19:19421138-19421160 CTTGTCTCTGTCCCCAGAATGGG - Intronic
1163994865 19:21034647-21034669 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1164047254 19:21553328-21553350 CCTGCCTCAGCCTCCAGAATAGG + Intronic
1164135600 19:22412939-22412961 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1164241120 19:23390068-23390090 CCTGTCTCAGCCTCCCGAAGTGG - Intronic
1164503282 19:28837249-28837271 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1164628568 19:29745985-29746007 CTTGCCTCAGCCTCCTGAGTAGG + Intergenic
1164832820 19:31335697-31335719 CTTGCCCCAGCCTCCTGAACAGG + Intronic
1164910602 19:32008197-32008219 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1164990591 19:32679809-32679831 CCTGTCTCAGCCTCCTGTCTGGG + Intergenic
1165141352 19:33702084-33702106 CCTGTCTCAGCCTCCCGAGTAGG + Intronic
1165219492 19:34303725-34303747 CTTGCCTCAGCCTCCCGAGTAGG + Intronic
1165497622 19:36162784-36162806 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1165524952 19:36346567-36346589 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1165590901 19:36968965-36968987 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1165593627 19:36992129-36992151 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1165699027 19:37923023-37923045 CCTGTCTCAGCCTCCCGAGTAGG - Intronic
1165728418 19:38128783-38128805 CCTGTCTCAGCCTCCCGAGTAGG - Intronic
1165744972 19:38225130-38225152 CCTGCCTCAGCCTCCTGAGTGGG - Intronic
1166047388 19:40237531-40237553 CCTGCCTCAGCCTCCCGAATAGG - Intronic
1166065104 19:40353316-40353338 CATGTCTCAACCTCCTGAGTAGG - Intronic
1166126804 19:40719599-40719621 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1166159019 19:40937748-40937770 CCAGTCTCAGCCTCCTGAGTAGG - Intergenic
1166403416 19:42501382-42501404 CCAGGCTCAGCCTCCTGAATAGG - Intergenic
1166520763 19:43478801-43478823 CCTGCCTCAGCCTCCTGAATAGG - Intronic
1166641195 19:44496559-44496581 CCTGCCTCAGCCGCCTGAATAGG - Intronic
1166648670 19:44553248-44553270 CATGCCTCAGCCTCCTGAGTAGG + Intergenic
1166724435 19:45017755-45017777 CTTGCCTCAGCCTCCTGAGTTGG + Intronic
1166735916 19:45084687-45084709 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1166817979 19:45558218-45558240 CCTGTCTCAGCCTCCCGAGTAGG - Intronic
1166937256 19:46341751-46341773 CCTGCCTCAGCCTCCTAAATTGG + Exonic
1166940572 19:46361651-46361673 CCTGTCTCAGCCTCCCGAGTAGG - Intronic
1166966640 19:46533213-46533235 CCTGTCTCTCCCTCCTCCATTGG - Intronic
1167009694 19:46799039-46799061 CCTGCCCCTGCCTCCTGAGTAGG - Intergenic
1167114764 19:47482815-47482837 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1167124311 19:47538874-47538896 CTTGTCTCTGCAGCCTGTACTGG - Intronic
1167164319 19:47788116-47788138 CTTGCCTCAGCCTCCTGACCAGG + Intergenic
1167232605 19:48294807-48294829 CCTGCCTCAGCCTCCGGAATAGG + Intergenic
1167446512 19:49541040-49541062 CTTGTTTCAGCCTCCTGAGTAGG + Intronic
1168000175 19:53439415-53439437 CCTGCCTCAGCCTCCCGAATAGG + Intronic
1168019767 19:53600857-53600879 CATGCCTCAGCCTCCTGAGTAGG + Intronic
1168265056 19:55218677-55218699 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1168286077 19:55334438-55334460 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1168345075 19:55646567-55646589 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1168537918 19:57186762-57186784 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1168622906 19:57893283-57893305 CTTGCCTCAGCCTCCTGAGTAGG + Intronic
1168655555 19:58125115-58125137 CCTGCCTCAGCCTCCTGAAGTGG + Intergenic
1168709991 19:58493969-58493991 CCTGTCTCAGCCTCCTGAGTAGG - Intronic
1202639434 1_KI270706v1_random:68961-68983 CTTTTCTCTTCCTCCTGGTTTGG - Intergenic
1202677638 1_KI270711v1_random:22197-22219 CCTGCCTCAGCCTCCTGAACAGG + Intergenic
924967117 2:88159-88181 CTTGCCTCTGCCTCCCAAAGTGG - Intergenic
925276549 2:2653121-2653143 CAAGTCTCTGTCTCCTGAAATGG + Intergenic
925625250 2:5836466-5836488 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
925911922 2:8579251-8579273 TTTGTCTCAGCCACCTGCATTGG - Intergenic
926279113 2:11430576-11430598 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
926394431 2:12426565-12426587 CTTGTGATTGCCTGCTGAATGGG + Intergenic
926691665 2:15739028-15739050 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
926903892 2:17787810-17787832 CTTGTCTCAGCCTCCCAAGTAGG - Exonic
926972212 2:18477844-18477866 CTTGTCTCTGCCTGGTAATTTGG - Intergenic
927600025 2:24432627-24432649 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
927669744 2:25059222-25059244 CTTGCCTCAGCCTCCCGAGTAGG + Intronic
927889030 2:26736901-26736923 CTTGCCTCAGCCCCCTGAGTAGG + Intergenic
927989580 2:27438073-27438095 CTTGCCTCAGCCTCCCGAGTAGG - Intronic
928236011 2:29541402-29541424 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
928330913 2:30357286-30357308 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
928514388 2:32031779-32031801 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
928566071 2:32551392-32551414 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
928636460 2:33251551-33251573 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
928705155 2:33941521-33941543 CCTGTCTCAGCCTCCTAACTGGG + Intergenic
929209966 2:39345264-39345286 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
929218460 2:39439286-39439308 CCTGCCTCGGCCTCCTGAAGTGG + Intergenic
929265646 2:39916253-39916275 CTTGCCTCAGCCTCCTGAGTAGG + Intergenic
929518353 2:42625141-42625163 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
929527569 2:42720292-42720314 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
929703668 2:44188505-44188527 CCCATCTCAGCCTCCTGAATTGG + Intronic
929827519 2:45320625-45320647 CCTGCCTCAGCCTCCCGAATAGG - Intergenic
929874475 2:45785377-45785399 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
930209590 2:48620663-48620685 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
930344706 2:50165458-50165480 CTTGCCTCAGCCTCCCGACTAGG + Intronic
930371154 2:50502839-50502861 CTTATCTCTGTCTGCTGAAGGGG + Intronic
930637461 2:53821992-53822014 CCTGCCTCTGCCTCCTGAGTAGG + Intergenic
930647898 2:53931164-53931186 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
930677649 2:54221630-54221652 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
930704317 2:54489207-54489229 CCTGCCTCTACCTCCTGAGTAGG - Intronic
930709388 2:54535906-54535928 CCTGTCTCAGCCTCCTGAATAGG - Intronic
930746155 2:54885333-54885355 CCTGTCTCAGCCTCCTGAGTAGG - Intronic
930777195 2:55184791-55184813 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
931350399 2:61482715-61482737 CCTGCCTCAGCCTCCCGAATAGG + Intronic
931459533 2:62438599-62438621 CATGCCTCAGCCTCCTGAGTAGG + Intergenic
931589031 2:63860704-63860726 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
931743899 2:65274878-65274900 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
932145950 2:69317409-69317431 CCTATCTCAGCCTCCTGAGTAGG + Intergenic
932298284 2:70644816-70644838 CTTGCCTCAGCCTCCCGAGTAGG + Intronic
932538443 2:72624492-72624514 CTTGTCTTGGCCTCCCAAATTGG - Intronic
932602946 2:73142689-73142711 CTTGCCTCAGCCTCCCGAGTAGG + Intronic
932608914 2:73184212-73184234 CCTGTCTCAGCCTCCCAAATAGG + Intergenic
932765968 2:74470236-74470258 CCTGTCTCAGCCTTCTGAGTAGG + Intergenic
933511791 2:83249256-83249278 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
933728639 2:85440435-85440457 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
933734164 2:85481754-85481776 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
933756552 2:85643757-85643779 CCTGCCTCAGCCTCCGGAATAGG + Intronic
933821078 2:86112568-86112590 CTTGCCTCAGCCTCCTGAATAGG - Intronic
933912901 2:86959843-86959865 CTTGTCTCTGCCTCCTGAATAGG + Intronic
933914345 2:86972860-86972882 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
934008648 2:87797039-87797061 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
934010094 2:87810047-87810069 CTTGTCTCTGCCTCCTGAATAGG - Intronic
934742247 2:96732858-96732880 CTTGCCTCAGCCTCCCGAGTAGG + Intronic
934964694 2:98710569-98710591 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
935418616 2:102844169-102844191 CTTGGCAGTCCCTCCTGAATGGG + Intergenic
935544402 2:104385595-104385617 CTTGTTTCAGCTCCCTGAATAGG - Intergenic
935658887 2:105448422-105448444 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
935772293 2:106438040-106438062 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
935773663 2:106450771-106450793 CTTGTCTCTGCCTCCTGAATAGG - Intronic
935906401 2:107845150-107845172 CTTGTCTCTGCCTCCTGAATAGG + Intronic
935907778 2:107857875-107857897 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
935992868 2:108737658-108737680 CCTGTCTCTGCCTCCGGAATAGG + Intronic
935994173 2:108750032-108750054 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
936128185 2:109810290-109810312 CTTGTCTCTGCCTCCTGAATAGG + Intronic
936129572 2:109823021-109823043 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
936215125 2:110548464-110548486 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
936216512 2:110561195-110561217 CTTGTCTCTGCCTCCTGAATAGG - Intronic
936400055 2:112158007-112158029 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
936408019 2:112225703-112225725 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
936424262 2:112403037-112403059 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
936425653 2:112415769-112415791 CTTGTCTCTGCCTCCTGAATAGG - Intronic
936460465 2:112710704-112710726 TCTGCCTCAGCCTCCTGAATAGG + Intergenic
936577057 2:113665992-113666014 CTTCTCTCTGCCACCTGTCTTGG + Intergenic
936598761 2:113874987-113875009 CCTGCCTCAGCCTCCTGAATAGG - Intergenic
936722429 2:115269033-115269055 CCCGTCTCAGCCTCCTGAGTAGG - Intronic
937002996 2:118485156-118485178 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
937287017 2:120760184-120760206 CCTGTCTCTGTCTGATGAATGGG + Intronic
937433622 2:121861968-121861990 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
937638957 2:124189930-124189952 CTTTTCTCTGCCTCCCAAGTGGG + Intronic
937837011 2:126481703-126481725 CCTGCCTCAGCCTCCTGATTAGG + Intergenic
937861753 2:126716823-126716845 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
938014340 2:127855279-127855301 CCTGCCTCGGCCTCCTGAGTAGG - Intronic
938273595 2:129996210-129996232 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
938442624 2:131349896-131349918 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
938515541 2:132002202-132002224 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
938884852 2:135634530-135634552 CCTGTCTCAGCCTTCTGAGTAGG - Intronic
938994355 2:136661624-136661646 CCTGCCTCAGCCTCCTGAAGTGG + Intergenic
939057795 2:137384398-137384420 CATCTCTCTCCCTCCTGAAGTGG - Intronic
939074981 2:137588889-137588911 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
939278294 2:140030026-140030048 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
939964568 2:148597751-148597773 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
940226132 2:151402819-151402841 CCTGCTTCAGCCTCCTGAATAGG - Intergenic
940510001 2:154602029-154602051 CCTGCCTCAGCCTCCCGAATAGG + Intergenic
940848875 2:158669861-158669883 CTTCTCTATGCCTCCTGAGTCGG - Exonic
940889377 2:159020223-159020245 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
940940250 2:159551355-159551377 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
941031424 2:160516103-160516125 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
942294417 2:174504126-174504148 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
942362606 2:175188204-175188226 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
942465745 2:176205692-176205714 CCTGCCACTGCCTCCTGAGTAGG - Intergenic
942905813 2:181179566-181179588 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
942914277 2:181284441-181284463 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
943433068 2:187828268-187828290 CTGGCCTCAGCCTCCTGAGTAGG + Intergenic
943507409 2:188779141-188779163 CCTGTCTCAGCCTCCTGAGTAGG + Intronic
944123036 2:196262135-196262157 CTTGCCTCAGTCTCCTGAGTAGG + Intronic
944152176 2:196571595-196571617 CGTGCCTCAGCCTCCTGAGTAGG - Intronic
944481767 2:200164477-200164499 CTTGCCTCTGCCTCCCAAAAGGG - Intergenic
944556012 2:200888635-200888657 CGTGTCTCAGCCTCCCGAGTAGG + Intronic
944686952 2:202126064-202126086 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
944700956 2:202245592-202245614 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
944726191 2:202473677-202473699 CGTGCCTCAGCCTCCCGAATAGG - Intronic
944749871 2:202697979-202698001 CTTGCCTCAGCCTCCTGAGTAGG + Intronic
944769444 2:202898863-202898885 CCTGCCTCAGCCTCCTGAATAGG - Intronic
944809728 2:203316301-203316323 CTTGCCTCAGCCTCCTGAGAAGG + Intergenic
944810707 2:203325042-203325064 CCTGTCTCAGTCTCCTGAGTAGG + Intergenic
944819984 2:203420503-203420525 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
944854591 2:203754687-203754709 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
944951982 2:204762231-204762253 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
945075916 2:206039283-206039305 CTTGCCTCAGCCTCCCGAGTAGG - Intronic
945215497 2:207429607-207429629 CCTGTCTCAGCCTCCTGAGTGGG - Intergenic
945287112 2:208094026-208094048 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
945628400 2:212239287-212239309 CCTGTCTCAGCATCCTGAGTAGG + Intronic
945660680 2:212681789-212681811 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
945875155 2:215270523-215270545 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
946076394 2:217077135-217077157 CTTGTCTTTGCTTCCTCAACTGG - Intergenic
946338411 2:219053781-219053803 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
946414678 2:219533919-219533941 CTTGCCTCAGCCTCCCGAATAGG - Intronic
946563082 2:220935044-220935066 CCTGTCTCAGCCTCCCAAATTGG + Intergenic
946803969 2:223451602-223451624 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
946838776 2:223798958-223798980 CCTGTCTCAGCCTCCTGAGTAGG - Intronic
946898665 2:224351528-224351550 CTTGGTTCTGCCTTCTGCATTGG - Intergenic
946952882 2:224896603-224896625 CATGTCTCAGCCTCCCGAGTAGG - Intronic
947030745 2:225791082-225791104 GCTGTCTCAGCCTCCTGAGTAGG + Intergenic
947049177 2:226022766-226022788 CCTGTCTCAGCCTCCTGAGTAGG - Intergenic
947122552 2:226832759-226832781 CCTGTCTCGGCCTCCCAAATGGG - Intergenic
947283268 2:228480454-228480476 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
947304417 2:228727842-228727864 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
947309803 2:228788877-228788899 CTGGTCTCTGACTCCTGAGCAGG + Intergenic
947352880 2:229264620-229264642 CTTGTCTCTGTCTCCTCACTTGG - Intronic
947357475 2:229312039-229312061 CATGCCTCAGCCTCCTGAGTAGG + Intergenic
947768349 2:232651708-232651730 CTTGCCTCAGCCTCCTGAGTAGG - Intronic
947784957 2:232809054-232809076 CCTGTCTCAGCCTCCTGAATAGG + Intronic
947786263 2:232823599-232823621 CTTGTCTCAGCCTCCCAAAGTGG + Intronic
947850567 2:233284441-233284463 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
948099256 2:235360306-235360328 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
948389969 2:237604889-237604911 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
948622192 2:239243262-239243284 CCTGCCTCAGCCTCCCGAATAGG + Intronic
948974263 2:241453893-241453915 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
949056463 2:241930546-241930568 CCTGCCTCGGCCTCCTGAGTAGG + Intergenic
949077990 2:242073545-242073567 CTTGTCTGTGTCTCCAGATTTGG - Intergenic
949084788 2:242143202-242143224 GTTGCCTCAGCCTCCTGAAGTGG + Intergenic
1168778319 20:467130-467152 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1168788332 20:558683-558705 CCTGCCTCAGCCTCCCGAATAGG + Intergenic
1169165984 20:3424323-3424345 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1169279769 20:4257049-4257071 GTTGTCTCAGCCTCCCTAATTGG - Intergenic
1169285097 20:4301186-4301208 CTTGCATGTGTCTCCTGAATTGG - Intergenic
1169293997 20:4376891-4376913 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1169574860 20:6948356-6948378 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1169756168 20:9045545-9045567 CATGTCTCAGTCTCCTGAGTAGG - Intergenic
1170057909 20:12227320-12227342 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1170102651 20:12719683-12719705 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1170241545 20:14172414-14172436 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1170617270 20:17963980-17964002 CTGCACTCAGCCTCCTGAATGGG - Intronic
1170920481 20:20674082-20674104 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1171029444 20:21664084-21664106 CTGACCTCAGCCTCCTGAATAGG + Intergenic
1171163747 20:22952447-22952469 CTTGTCTCTGCCTCCATACTGGG - Intergenic
1171288905 20:23968723-23968745 CTTCTCTGTGCCTCCTCAACTGG - Intergenic
1171347414 20:24476556-24476578 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1171506431 20:25639355-25639377 CCTGCCTCAGCCTCCCGAATAGG + Intergenic
1172336026 20:34116237-34116259 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1172352894 20:34257193-34257215 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1172359126 20:34300071-34300093 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1172522636 20:35578231-35578253 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1172538634 20:35693848-35693870 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1172553093 20:35817296-35817318 CTTGCCTCAGCCTCCCAAATAGG + Intronic
1172695766 20:36821948-36821970 CTTTTCTCTGCCTGCTGGAAAGG - Intronic
1172711550 20:36928571-36928593 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1172719808 20:36991077-36991099 CCTGCCTCAGTCTCCTGAATAGG + Intergenic
1173040805 20:39460459-39460481 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1173344311 20:42184737-42184759 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1173610771 20:44365893-44365915 CTTGCCTCAGCCTCCCGAGTAGG - Intronic
1173782743 20:45770221-45770243 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1174000616 20:47371788-47371810 CTTGCCTCTGCCTCCTGAGTAGG - Intergenic
1174249608 20:49208729-49208751 CCTGTCTCAGCCTCCCGAGTAGG + Intergenic
1174346269 20:49932408-49932430 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1174380099 20:50150805-50150827 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1174602862 20:51738975-51738997 CTTGTCTCAGCCTCCTGAATAGG - Intronic
1174617820 20:51849854-51849876 CATGCCTCAGCCTCCTGAGTAGG - Intergenic
1174640210 20:52037193-52037215 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1174801275 20:53564965-53564987 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1175054548 20:56186129-56186151 CCTGCCTCAGCCTCCTGAATAGG - Intergenic
1175416010 20:58801440-58801462 CCTGCCTCAGCCTCCTGAGTCGG - Intergenic
1176177036 20:63733570-63733592 CTTGTCTCTGCCCCCAGATGTGG + Exonic
1176281367 20:64315678-64315700 GTTGCCTCAGCCTCCTGAAGTGG + Intergenic
1176414172 21:6465657-6465679 CCTGTCTCAGCCTCCTGAGTAGG + Intergenic
1176663823 21:9665167-9665189 CTTGTCTCTTCCTCTTGACTTGG + Intergenic
1176850338 21:13907851-13907873 CTTTTCTCTTCCTCCTGGCTTGG - Intergenic
1177012886 21:15750339-15750361 CTTCTGTCAGCCTCCTGAGTAGG + Intronic
1177146834 21:17415811-17415833 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1177440497 21:21116741-21116763 CCTGGCTCAGCCTCCTGAGTAGG - Intronic
1177514343 21:22129311-22129333 CTTGCCTCTGCCTCCTGAGTAGG + Intergenic
1177745514 21:25208161-25208183 CTTGTCTTTGCATCTTTAATGGG + Intergenic
1177747867 21:25242912-25242934 CGTGCCTCAGCCTCCTGAGTAGG - Intergenic
1177817311 21:25991487-25991509 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1177835240 21:26180277-26180299 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1177918123 21:27116326-27116348 CCTGCCTCAGCCTCCTGAGTGGG + Intergenic
1177936290 21:27350566-27350588 TTTGTTTCTGCCTTCTGTATGGG - Intergenic
1177975866 21:27849732-27849754 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1177980716 21:27911535-27911557 CCTGCCTCAGCCTCCTGAATAGG - Intergenic
1178285908 21:31325170-31325192 CCTACCTCTGCCTCCTGAGTAGG - Intronic
1178307074 21:31499736-31499758 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1178344174 21:31810956-31810978 CCTGCCTCAGCCTCCTGAATAGG + Intergenic
1178399634 21:32274314-32274336 CCTGTCTCAGCCTCTTGAGTAGG + Intronic
1178543448 21:33474661-33474683 CCTGCCTCAGCCTCCTGAATAGG - Intronic
1178576746 21:33799512-33799534 CTTGTCTCTGCCTCTTTCCTTGG - Intronic
1178808985 21:35863684-35863706 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1178949143 21:36971715-36971737 CCTGGCTCAGCCTCCTGAGTAGG - Intronic
1179665126 21:42905973-42905995 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1179672268 21:42957972-42957994 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1179689670 21:43073979-43074001 CCTGTCTCAGCCTCCTGAGTAGG + Intronic
1179877098 21:44274382-44274404 CCTGTCTCAGCCTCCCGAGTAGG + Intergenic
1180034593 21:45238132-45238154 CTTTTCTCAGCCGCCTGAGTAGG + Intergenic
1180313877 22:11260600-11260622 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1180362509 22:11912903-11912925 CTTTTCTCTTCCTCCTGGCTTGG + Intergenic
1180461515 22:15569878-15569900 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1180538457 22:16418770-16418792 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1180639631 22:17288011-17288033 CTTGCCTGAGCCTCCTGAGTAGG + Intergenic
1180922618 22:19528959-19528981 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1180930401 22:19586619-19586641 CATGCCTCAGCCTCCCGAATAGG - Intergenic
1180957792 22:19748788-19748810 CTTTTTTCTGACTCCAGAATTGG - Intergenic
1180974453 22:19839766-19839788 CCTGTCTCAGCCTCCTGAGCAGG - Intronic
1181134662 22:20756330-20756352 CCTGTCTCAGCCTCCCGAGTAGG + Intronic
1181299604 22:21870085-21870107 CCTGTCTCAGCCTCCGGAGTAGG - Intergenic
1181945826 22:26516951-26516973 CCTGTCTCAGCCTCCTGAGTAGG + Intergenic
1181994067 22:26860970-26860992 CCTGCCTCTGCCTCCCGAGTAGG + Intergenic
1182217590 22:28732051-28732073 CCTGTCTCAGCCTCCTGTGTGGG + Intronic
1182375158 22:29841467-29841489 CTTGCCTCAGTCTCCTGAGTAGG + Intergenic
1182387546 22:29958248-29958270 CTTGTTTCTGCCACCTGTTTAGG + Intronic
1182488387 22:30653481-30653503 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1182506203 22:30784882-30784904 CCTGTCTCAGCCTCCTGAGTAGG + Intronic
1182603450 22:31485690-31485712 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1182665720 22:31958381-31958403 CATGCCTCAGCCTCCTGAGTAGG + Intergenic
1182832803 22:33317100-33317122 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1183186792 22:36296344-36296366 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1183390219 22:37541457-37541479 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1183400150 22:37598590-37598612 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1183514335 22:38255135-38255157 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1183530729 22:38351961-38351983 CTTGTCCCTACCTCCTGAGGCGG + Intronic
1183824651 22:40375927-40375949 CTTGCCTCAGCATCCTGAGTAGG - Intronic
1183848684 22:40564761-40564783 CCTGCCTCAGCCTCCCGAATAGG + Intronic
1184123030 22:42465872-42465894 CCTGACTCAGCCTCCTGAGTAGG - Intergenic
1184367447 22:44061317-44061339 CCAGCCTCAGCCTCCTGAATAGG - Intronic
1185207960 22:49551039-49551061 CTTCTCTCTGCCTTGTGTATGGG - Intronic
1185423183 22:50746684-50746706 CTTCTCTCTGCCACCTGTCTTGG - Intergenic
1203288513 22_KI270735v1_random:9228-9250 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
949096855 3:96616-96638 CCTACCTCAGCCTCCTGAATAGG - Intergenic
949391346 3:3566064-3566086 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
949635406 3:5976661-5976683 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
950064629 3:10102253-10102275 CCTGTCTCAGCCCCCTGTATAGG + Intronic
950406576 3:12808835-12808857 CCTGTCTCTGCCTTCTGGACTGG - Intronic
950552960 3:13678170-13678192 CTTGTCTCAGCCTCCTGAGTAGG + Intergenic
950732271 3:14971227-14971249 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
950738467 3:15030714-15030736 CATGCCTCAGCCTCCTGAGTAGG - Intronic
950775295 3:15344688-15344710 CCTGCCTCGGCCTCCTGAGTAGG + Intergenic
950787203 3:15446705-15446727 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
951152926 3:19313817-19313839 CTTTTATCTTTCTCCTGAATAGG - Intronic
951172895 3:19563190-19563212 CATGTCTCAGCCTCCTGAGTAGG + Intergenic
951185580 3:19708824-19708846 CGTGCCTCAGCCTCCTGAGTAGG - Intergenic
951231155 3:20181013-20181035 CCCATCTCAGCCTCCTGAATAGG - Intronic
951692663 3:25412905-25412927 CCTGCCTCAGCCTCCTGAATAGG - Intronic
951903519 3:27680585-27680607 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
951916190 3:27803318-27803340 CTTGCCTCAGCCTCCTGAGTAGG + Intergenic
952156814 3:30652344-30652366 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
952181877 3:30925436-30925458 CTTACCTCTGCCTCATGAATGGG + Intergenic
952300431 3:32100017-32100039 CCTGCCTCAGCCTCCTGAATAGG + Intergenic
952375461 3:32763536-32763558 CCTGTCTCAGCCTCCTGAGTAGG - Intronic
952459956 3:33514097-33514119 CTTGCCTCAGCCTCCCAAATTGG + Intronic
952603606 3:35115483-35115505 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
952661115 3:35849034-35849056 CATGCCTCAGCCTCCTGAGTAGG + Intergenic
953109673 3:39921768-39921790 CCTGTCTCAGCCTCCTGAGTAGG - Intronic
953145385 3:40270150-40270172 GAGGGCTCTGCCTCCTGAATGGG - Intergenic
953147491 3:40291824-40291846 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
953194786 3:40722168-40722190 CATGGCTCTGCCTCCTCACTGGG - Intergenic
953281965 3:41567556-41567578 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
953360766 3:42294345-42294367 CCTGCCTCAGCCTCCTGAATAGG + Intergenic
953584659 3:44188789-44188811 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
953705479 3:45226694-45226716 CTTGTTTCTGGCTCATGAGTTGG - Intergenic
954046763 3:47938254-47938276 CCTGTCTCAGCCTCCCGAGTAGG - Intronic
954061700 3:48073096-48073118 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
954172293 3:48814304-48814326 CTTGCCTCAGCCTCCTGAGTAGG - Intronic
954172649 3:48817213-48817235 CCTGCCTCAGCCTCCCGAATCGG - Intronic
954184793 3:48908716-48908738 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
954233127 3:49234282-49234304 CCTGCCTCAGCCTCCTGATTAGG + Intronic
954260778 3:49437136-49437158 CCTGTCTCAGCCTCCTGAGTAGG - Intergenic
954483982 3:50828823-50828845 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
954533194 3:51338441-51338463 CTTCTCTCTGCCTACTGAAATGG + Intronic
954554038 3:51504457-51504479 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
954623839 3:52011534-52011556 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
954838549 3:53492641-53492663 CCTGCCTCAGCCTCCTGAATAGG - Intergenic
955252109 3:57294286-57294308 CTTGTCTCAGCCTCCTGAGTAGG + Intronic
955392623 3:58532495-58532517 CCTGTCTCAGCCTCCCGAGTAGG + Intronic
955443749 3:58985010-58985032 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
955494889 3:59520853-59520875 CGTGCCTCAGCCTCCTGAGTAGG + Intergenic
955527852 3:59839204-59839226 CCTGTCTCAGCCTCCTGAGTAGG - Intronic
955680189 3:61491995-61492017 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
955681098 3:61503153-61503175 CTTGCCTCAGCCTCCCGAGTAGG + Intergenic
955956931 3:64300182-64300204 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
956101108 3:65769375-65769397 CCTGCCTCAGCCTCCTGAATAGG - Intronic
956301099 3:67773614-67773636 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
956708465 3:72019722-72019744 TCTGTCTCAGCCTCCTGAGTAGG - Intergenic
956842262 3:73151723-73151745 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
957189070 3:76983171-76983193 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
957854043 3:85850434-85850456 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
958425544 3:93974569-93974591 CCTGTCTCAGCCTCCTGAGTAGG + Intergenic
958476640 3:94592290-94592312 CCTGCCTCCGCCTCCTGAGTAGG - Intergenic
958603212 3:96325889-96325911 CCTGTCTCAGCCTCCGGAGTAGG - Intergenic
958672395 3:97221196-97221218 CCTGTCTCAGCCTCCCGAGTTGG - Intronic
958910359 3:99987116-99987138 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
959053093 3:101542894-101542916 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
959066907 3:101666860-101666882 CCTGTCTCAGCCTCCGGAGTAGG + Intronic
959140700 3:102483437-102483459 CATGCCTCAGCCTCCTGAATAGG + Intergenic
959146695 3:102555278-102555300 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
959220148 3:103507911-103507933 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
959833583 3:110892802-110892824 CCTGCCTCAGCCTCCCGAATAGG + Intronic
959974943 3:112448300-112448322 CCTGTCTCAGCCTCCTGAGTAGG + Intergenic
960041251 3:113151869-113151891 CTATTCTCTGCCTCTTGAGTGGG - Intergenic
960119352 3:113931468-113931490 CCTGTCTCAGCCTCCTGAGTAGG + Intronic
960119401 3:113931812-113931834 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
960196117 3:114770326-114770348 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
960601923 3:119467493-119467515 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
961010500 3:123432640-123432662 CTTGCCTCAGCCTCCTAACTGGG + Intronic
961067308 3:123886507-123886529 CCTGCCTCAGCCTCCTGAATAGG + Intergenic
961147247 3:124604796-124604818 CTTGTCTCAGCCTCCTGAGTAGG + Intronic
961224125 3:125223841-125223863 CTTGCTTCAGCCTCCTGAGTAGG - Intergenic
961243102 3:125429443-125429465 CCTGCCTCAGCCTCCTGACTAGG - Intergenic
961256600 3:125559772-125559794 CCTGTCTCAGCCTCCTGAGACGG + Intronic
961748162 3:129079159-129079181 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
961848535 3:129791203-129791225 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
962061698 3:131934737-131934759 TTTGTCTCTGCTTCCTAACTGGG - Intronic
962504660 3:136034145-136034167 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
962547050 3:136447355-136447377 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
962685364 3:137842517-137842539 CTTGCCTCAGCCTCCCGAGTAGG - Intergenic
962790773 3:138809492-138809514 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
963206266 3:142638851-142638873 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
963563780 3:146901573-146901595 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
963572613 3:147016364-147016386 CCTGTCTCAGCCTCATGAGTAGG - Intergenic
963798152 3:149651939-149651961 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
963809450 3:149760528-149760550 CTGGCCTCAGCCTCCTGAGTAGG - Intergenic
963961793 3:151317560-151317582 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
964014591 3:151929567-151929589 CTTGTCTCTGCTACCTGCACTGG + Intergenic
964084692 3:152802226-152802248 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
964102352 3:153002469-153002491 CCTGTCTCAGCCTCCTGAGTAGG + Intergenic
964598511 3:158466945-158466967 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
964604042 3:158539899-158539921 CTTATCTCTGCTACCTGAAGAGG + Intronic
964801031 3:160557784-160557806 CCTGCCTCAGCCTCCTAAATAGG + Intronic
964901566 3:161665332-161665354 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
964923250 3:161924394-161924416 CCTGCCTCAGCCTCCTGAGTGGG + Intergenic
965040781 3:163503715-163503737 CCTGCCTCAGCCTCCTGAATAGG - Intergenic
965094464 3:164206986-164207008 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
965456357 3:168905860-168905882 CCTGTCTCAGCCTCCTGAGTAGG + Intergenic
965536501 3:169828966-169828988 CCTGTCACTGCCTCTTAAATTGG + Intronic
965782185 3:172297584-172297606 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
965824008 3:172712540-172712562 CTTGCCTCAGCCTCCTCAGTAGG + Intergenic
965869965 3:173253306-173253328 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
966005946 3:175012274-175012296 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
966011065 3:175078134-175078156 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
966176922 3:177148601-177148623 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
966179669 3:177176701-177176723 GCTGCCTCAGCCTCCTGAATAGG - Intronic
966179949 3:177179003-177179025 CTTGCCTCCGCCTCCCGAGTAGG - Intronic
966877241 3:184329515-184329537 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
967012717 3:185451753-185451775 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
967030085 3:185597763-185597785 CCTGCCTCAGCCTCCTGAATAGG + Intronic
967085597 3:186092542-186092564 CTTGCCTCAGCCTCCAGAGTAGG + Intronic
967146511 3:186611335-186611357 CCTGTCTCGGCCTCCCGAGTAGG + Intergenic
967338113 3:188367006-188367028 CCTGCCTCAGCCTCCCGAATAGG + Intronic
967793215 3:193571164-193571186 CCTGCCTCAGCCTCTTGAATAGG - Intronic
967806433 3:193718121-193718143 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
967857425 3:194128932-194128954 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
967875252 3:194264514-194264536 CCTGCCTCCGCCTCCTGAGTAGG - Intergenic
967906632 3:194506920-194506942 CTTGCCTCAGCCTCCTGAGTAGG - Intergenic
968034214 3:195532140-195532162 CCTGCCTCAGCCTCCTGACTAGG + Intronic
968044950 3:195618771-195618793 CTGGTCTCTGCTTCTGGAATGGG - Intergenic
968060734 3:195724823-195724845 CTGGTCTCTGCTTCTGGAATGGG - Exonic
968082386 3:195855381-195855403 CCTGCCTCAGCCTCCTGAATAGG - Intergenic
968142719 3:196272294-196272316 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
968199115 3:196737407-196737429 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
968203968 3:196781992-196782014 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
968633451 4:1665204-1665226 CTTGCCTCAGTCTCCTGAGTAGG - Intronic
968717828 4:2174932-2174954 CCTGTCTCAGCCTCTTGAGTAGG + Intronic
968763499 4:2455575-2455597 CATGCCTCAGCCTCCTGAGTTGG - Intronic
968789728 4:2651216-2651238 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
969110636 4:4841963-4841985 CATGCCTCAGCCTCCTGAGTAGG - Intergenic
969399905 4:6947548-6947570 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
969407545 4:7003890-7003912 CTTGCCTCAGCCTCCTGAATAGG - Intronic
969928890 4:10611384-10611406 CATGCCTCAGCCTCCTGAATAGG - Intronic
970090824 4:12405941-12405963 CCTGACTCAGCCTCCTGAGTAGG - Intergenic
970258659 4:14198947-14198969 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
971479504 4:27101821-27101843 CTGTTCTCAGCCTCCTGAAAAGG - Intergenic
971625983 4:28920762-28920784 TCTGTCTCAGCCTCCTGAGTAGG - Intergenic
971684161 4:29743284-29743306 CCTATCTCAGCCTCCTGAGTAGG - Intergenic
971734638 4:30431130-30431152 CATGCCTCCGCTTCCTGAATTGG - Intergenic
971849425 4:31964381-31964403 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
972300647 4:37782599-37782621 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
972500780 4:39675957-39675979 CCTGTCTCAGCCTCCTGAGTAGG - Intergenic
972774926 4:42231696-42231718 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
973058249 4:45687278-45687300 CCTGCCTCAGCCTCCTGAGTTGG - Intergenic
973612629 4:52650980-52651002 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
973627407 4:52786698-52786720 CTTGGCTCTGCCTCCTCCAGTGG - Intergenic
973680354 4:53311745-53311767 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
974007608 4:56574305-56574327 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
974024861 4:56724742-56724764 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
974037939 4:56833368-56833390 CATGCCTCCGCCTCCCGAATAGG + Intergenic
974049722 4:56929177-56929199 CGTGTCTCAGCCTCCTGAATAGG + Intronic
974311701 4:60219632-60219654 CCTACCTCAGCCTCCTGAATGGG - Intergenic
974579420 4:63776765-63776787 CCTGCCTCACCCTCCTGAATAGG + Intergenic
974703492 4:65482184-65482206 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
974862033 4:67533924-67533946 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
974922129 4:68254863-68254885 CCTGCCTCAGCCTCCTGAATAGG - Intergenic
975109625 4:70608978-70609000 CCTGTCTCAGCCTCCTGAGTAGG - Intergenic
975131143 4:70834145-70834167 CCTGCCTCAGCCTCCTGAGTTGG - Intronic
975561448 4:75711599-75711621 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
975788455 4:77920872-77920894 TGTGTCTCAGCCTCCTGAGTAGG + Intronic
976182204 4:82409344-82409366 CCTGCCTCAGCCTCCCGAATTGG - Intergenic
976210628 4:82665121-82665143 CCTGCCTCAGCCTCCTGAGTCGG - Intronic
976212249 4:82682925-82682947 CCTGTCTCAGCCTCCCGAATAGG + Intronic
976339855 4:83934893-83934915 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
976696933 4:87926903-87926925 TTTGCCTCTGGCTCCTGATTGGG + Intergenic
976743216 4:88378327-88378349 CTTGCCTCGGCCTCCCGAGTAGG - Intergenic
976882876 4:89950803-89950825 CTTGCCTTGGCCTCCTGAAGTGG + Intronic
977119729 4:93083582-93083604 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
977208430 4:94190435-94190457 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
977649445 4:99453444-99453466 CTTGTCTCTGGTTTCAGAATGGG + Intergenic
977713017 4:100149128-100149150 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
977756319 4:100676270-100676292 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
978308093 4:107354194-107354216 CTTGGCTCTGCCTTCTAGATAGG - Intergenic
978371819 4:108036756-108036778 CCTGCCTCAGCCTCCCGAATAGG + Intergenic
978453802 4:108865878-108865900 CTGGCCTCAGCCTCCTGAGTAGG + Intronic
978522050 4:109626699-109626721 CCTGCCTCAGCCTCCCGAATAGG - Intronic
978523782 4:109643614-109643636 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
978655603 4:111062077-111062099 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
978753612 4:112280459-112280481 CCTGTCTCAGCCTCCCGAGTAGG + Intronic
978880079 4:113691323-113691345 GCTATCTGTGCCTCCTGAATTGG + Intronic
978883069 4:113731695-113731717 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
979015728 4:115431264-115431286 CCTGCCTCGGCCTCCTGAGTAGG - Intergenic
979035889 4:115716861-115716883 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
979240244 4:118441369-118441391 TTTCTCTCTGCCTCCTCACTTGG + Intergenic
979252587 4:118580979-118581001 CATGCCTCAGCCTCCTGAGTAGG + Intergenic
979262225 4:118661443-118661465 GTTGCCTCAGCCTCCTGAAGTGG + Intergenic
979388030 4:120093030-120093052 CCTGTCTCAGCCTCCTGAGTAGG + Intergenic
979451118 4:120872037-120872059 CTTTTCTCAGCCTCCTGAGTAGG - Intronic
979683191 4:123483733-123483755 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
979946161 4:126833872-126833894 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
980002399 4:127505925-127505947 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
980048668 4:128016661-128016683 CCTGTCTCAGTCTCCTGAGTAGG - Intronic
980229829 4:130034617-130034639 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
980476120 4:133319246-133319268 TTTGCCTCGGCCTCCTGAGTAGG + Intergenic
980850796 4:138379129-138379151 CCTGTCTTAGCCTCCTGAGTAGG + Intergenic
981038200 4:140194060-140194082 CATGCCTCAGCCTCCTGAGTGGG - Intergenic
981278087 4:142925304-142925326 CCTGTCTCTGCCTACTGAGAAGG + Intergenic
981310537 4:143293940-143293962 CCTATCTCAGCCTCCTGAGTAGG + Intergenic
981537215 4:145812637-145812659 CCTGTCTCAGCCTCCTGGGTAGG + Intronic
981639731 4:146926983-146927005 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
981908396 4:149950355-149950377 CCTGTCTCAGCCTCCAGAGTAGG - Intergenic
981982556 4:150811612-150811634 CCTGTCTCAGCCTTCTGAGTAGG + Intronic
982178263 4:152726986-152727008 CCTGACTCAGCCTCCTGAGTAGG + Intronic
982267430 4:153551467-153551489 CCTGCCTCAGCCTCCTGAATAGG + Intronic
982907678 4:161096768-161096790 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
983149614 4:164261892-164261914 GTTGCCTCAGCCTCCTGAAGTGG - Intronic
983199049 4:164841025-164841047 TTTGCCTCAGCCTCCTGATTAGG - Intergenic
983394994 4:167182649-167182671 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
983399649 4:167246571-167246593 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
983407956 4:167354663-167354685 CTTGCCTCAGCCTCCTGAGCTGG - Intergenic
983611708 4:169653527-169653549 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
984120002 4:175730580-175730602 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
984394118 4:179171834-179171856 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
984631710 4:182067646-182067668 CTAGTTTCTGCCTCCTGAGATGG + Intergenic
984892053 4:184502981-184503003 CTCGTCTCTGCCTCCACAGTCGG - Intergenic
984967743 4:185155265-185155287 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
985177743 4:187220502-187220524 CTTGTCACTGGCTCCTCATTTGG + Intergenic
985409281 4:189665849-189665871 CTTGTCTCTTCCTCTTGACTTGG + Intergenic
1202766792 4_GL000008v2_random:154830-154852 CTTTTCTCTTCCTCCTGGCTTGG - Intergenic
985500163 5:238614-238636 CCTGTCTCAGCCTCCCGAAGTGG + Intronic
986672181 5:10152195-10152217 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
987300080 5:16589484-16589506 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
987603378 5:20101957-20101979 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
987840511 5:23217557-23217579 CTTGATTCTTCCTCCTGAACAGG - Intergenic
987905493 5:24070547-24070569 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
988071323 5:26291711-26291733 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
988203226 5:28097127-28097149 CTTGTCTCAGTCTCCCGAAATGG + Intergenic
988335467 5:29902877-29902899 TTTGTCTCTGAATCCAGAATAGG - Intergenic
988549193 5:32185091-32185113 CCTGCCTCAGCCTCCTGAATAGG - Intergenic
989212666 5:38871570-38871592 CTTGGCTCTGCCTCGTTGATTGG - Intronic
989256880 5:39375772-39375794 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
989357401 5:40560072-40560094 CTTGCCTCAACCTCCTGAGTAGG - Intergenic
989374878 5:40750444-40750466 CCTGCCTCTGTCTCCTGAGTAGG - Intronic
989524465 5:42437657-42437679 CTTGCCTCTGCCTCCTGAGTAGG + Intronic
989601423 5:43204197-43204219 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
989627935 5:43450104-43450126 CTTGCCTCAGCCTCCTGATTAGG + Intronic
990204780 5:53417020-53417042 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
990240545 5:53812180-53812202 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
990450322 5:55927191-55927213 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
990476526 5:56166367-56166389 CCAGTCTCAGCCTCCTGAATAGG + Intronic
990567582 5:57044442-57044464 CTTGCCTCAGCCTCCTGAGTAGG - Intergenic
990580107 5:57159933-57159955 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
990907498 5:60819672-60819694 CGTGCCTCAGCCTCCTGAGTAGG - Intronic
991143073 5:63269184-63269206 CCTGCCTCAGCCTCCTGAGTTGG - Intergenic
991150961 5:63369322-63369344 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
991184108 5:63787542-63787564 CCTGACTCAGCCTCCTGAGTAGG - Intergenic
991269118 5:64758278-64758300 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
991593507 5:68278826-68278848 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
991904387 5:71494808-71494830 TTTGCCTCAGCCTCCTGAGTAGG + Intronic
991905433 5:71505251-71505273 CCTGTCTCGGCCTCCTAAAGTGG + Intronic
992372062 5:76153389-76153411 CTTCTCTCTGCTTCCTGAAGAGG + Intronic
992457092 5:76925853-76925875 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
992533954 5:77679725-77679747 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
992553214 5:77879097-77879119 CTTACCTCTGCCTCTTTAATAGG + Intergenic
992604610 5:78442380-78442402 CCTGTCTCAGCCTCCTGAGTAGG + Intronic
992923310 5:81550982-81551004 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
993004201 5:82413015-82413037 CTTGTCTGAGTCCCCTGAATGGG + Intergenic
993023787 5:82623678-82623700 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
993248048 5:85477336-85477358 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
993291906 5:86082861-86082883 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
993300356 5:86201682-86201704 CCTGTCTCAGCCTCCTGAGTAGG + Intergenic
993495251 5:88601593-88601615 CCTGCCTCAGCCTCCTGAGTTGG - Intergenic
993507819 5:88732972-88732994 CTTGTCTTTGCATCCTCACTGGG - Intronic
993618326 5:90138668-90138690 CTTGCCTGTGGCTCCTGGATTGG + Intergenic
993629014 5:90260998-90261020 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
993809929 5:92463582-92463604 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
993952209 5:94190435-94190457 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
994047565 5:95327082-95327104 CCTGCTTCAGCCTCCTGAATAGG + Intergenic
994425980 5:99587514-99587536 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
994767339 5:103935342-103935364 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
994907816 5:105863419-105863441 CCTGCCTCAGCCTCCTGAGTTGG - Intergenic
994931082 5:106186945-106186967 CCTGCCTCAGCCTCCCGAATAGG + Intergenic
995985385 5:118164633-118164655 TATGTCTCTCCCTCCTGAACAGG - Intergenic
996330137 5:122319408-122319430 CTTTTCTGTGCCTCCTCAAGAGG - Intronic
996698338 5:126423315-126423337 CTCTTCTCTGCCTCCTGGGTTGG + Intronic
996713968 5:126571364-126571386 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
996716489 5:126592043-126592065 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
996733779 5:126740650-126740672 CCTGTCTCAGCCTCCCGAGTAGG + Intergenic
997242716 5:132319702-132319724 CCTGTCTCAGCCTCCCGAATAGG + Intronic
997535516 5:134617791-134617813 CCTGTCTCTGCCTCCCGAGTAGG + Intronic
997541463 5:134666443-134666465 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
997545674 5:134705185-134705207 CCTGTCTCTGCCTCTGGAGTAGG + Intronic
997553033 5:134770320-134770342 CTTGTTTCTGCCTCCTCAGTAGG + Intronic
997787874 5:136729852-136729874 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
998024141 5:138799270-138799292 CCTGCCTCTGCCTCCTGAGTAGG + Intronic
998052757 5:139049679-139049701 ATTGTCTCAACCTCCTGAGTAGG - Intronic
998174728 5:139894789-139894811 TTGGTCTCTGCCTCCTGTTTAGG + Intronic
998237086 5:140407181-140407203 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
998247834 5:140525005-140525027 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
998336613 5:141377357-141377379 CCTGCCTCAGCCTCCTGAAGAGG - Intronic
998466598 5:142349526-142349548 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
998838015 5:146222570-146222592 CCTGCCTCGGCCTCCTGAGTAGG - Intronic
999163858 5:149530852-149530874 CCTGTCTCAGCCTCCTGAGTAGG - Intronic
999247519 5:150162992-150163014 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
999290397 5:150421777-150421799 CTTGCCTCAGCCTCCTGAGTAGG + Intergenic
999363313 5:151004364-151004386 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
999873063 5:155772461-155772483 CCTGTCTCTGCCTGATGAAGTGG - Intergenic
1000340374 5:160272462-160272484 CTTGTCTGTGCTTCCTGGATAGG + Intronic
1000613087 5:163396884-163396906 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1000692589 5:164341956-164341978 CCTGTCTCAGCCTCCTGAGTAGG + Intergenic
1000849491 5:166322526-166322548 CTTGCCTCAGCCTTCTGAGTAGG + Intergenic
1001005702 5:168047922-168047944 CTGCTCTCTGCCTTCTGATTAGG - Intronic
1001039594 5:168324319-168324341 CCTGCCTCGGCCTCCTGAGTAGG - Intronic
1001261252 5:170231544-170231566 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1001387573 5:171352688-171352710 CCTGTCTCAGCCTCCTGAGTAGG - Intergenic
1001393638 5:171401244-171401266 CCTGTCTCCACCTCCTGAGTAGG - Intronic
1001464434 5:171950773-171950795 CCTGCCTCAGCCTCCTGAATAGG - Intronic
1001517846 5:172369004-172369026 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1002367907 5:178727960-178727982 CTTGCCTCGGCCTCCTGAGTAGG + Intronic
1002497606 5:179625878-179625900 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1002740496 5:181431952-181431974 TTTCTCTCTGCCTCCTCACTTGG + Intergenic
1002858547 6:1059114-1059136 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1002950020 6:1800546-1800568 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1003280784 6:4689717-4689739 CCTGCCTCAGCCTCCTGAATAGG - Intergenic
1003508242 6:6757652-6757674 CCTGTCTCAGCCTCCCGAGTAGG - Intergenic
1003672997 6:8177194-8177216 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1003865729 6:10360880-10360902 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1003923883 6:10858586-10858608 CCTGGCTCAGCCTCCTGAGTAGG - Intronic
1004035021 6:11915597-11915619 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1004150521 6:13115432-13115454 CTTGATTCTGCCTCCTAAAGGGG + Intronic
1004305267 6:14495988-14496010 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1004365381 6:15008433-15008455 CTTGTCCCTGGCTTCTGATTGGG + Intergenic
1004396606 6:15251121-15251143 CCTGTCTCAGCCTCCCGAGTAGG + Intronic
1004650734 6:17605190-17605212 CCTGTCTCAGCCTCCTGAGTAGG + Intronic
1004702618 6:18093221-18093243 CCTGTCTCAGCCTCCCGAGTAGG + Intergenic
1005062735 6:21792302-21792324 CTTGCCTCAGCCTCCCGAGTAGG + Intergenic
1005154620 6:22790655-22790677 CCTGCCTCGGCCTCCTGAGTAGG + Intergenic
1005500356 6:26423906-26423928 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1005508724 6:26493106-26493128 CTTGCCTCAGCCTCCTGAGTAGG - Intergenic
1005607422 6:27488809-27488831 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1005722814 6:28619618-28619640 CGTGCCTCAGCCTCCTGAGTAGG + Intergenic
1005752872 6:28899617-28899639 CCTGTCTCAGCCTCCCGAGTCGG + Intergenic
1005827191 6:29640206-29640228 CTTGCCTCAGCCTCCCGAGTAGG - Intergenic
1005931390 6:30487441-30487463 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1005957531 6:30674818-30674840 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1005978327 6:30816901-30816923 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1006139408 6:31919254-31919276 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1006227893 6:32555975-32555997 CCTGACTCAGCCTCCTGAGTTGG + Intronic
1006290901 6:33135939-33135961 CCTGCCTCAGCCTCCTGAATAGG + Intergenic
1006564265 6:34941097-34941119 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1006573141 6:35021872-35021894 CTTGCCTCAGCCTGCTGAGTGGG - Intronic
1006646077 6:35515199-35515221 CCTGTCTCAGCCTCCTGAGTAGG + Intergenic
1006703724 6:35998441-35998463 CCTGTCTCAGCCTCCTGAGTAGG - Intronic
1006782342 6:36640553-36640575 CCTGCCTCAGCCTCCCGAATAGG + Intergenic
1006861819 6:37176723-37176745 CCTGCCTCAGCCTCCTGCATAGG - Intergenic
1007002896 6:38331365-38331387 TATGTCTCAGCCTCCTGAGTAGG - Intronic
1007036732 6:38681173-38681195 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1007048545 6:38802042-38802064 CTTGCCTCAACCTCCTGAGTAGG + Intronic
1007258801 6:40547615-40547637 ATGCCCTCTGCCTCCTGAATAGG + Intronic
1007306791 6:40913018-40913040 CCTGCCTCGGCCTCCTGAGTAGG - Intergenic
1007435794 6:41809713-41809735 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1007437939 6:41830709-41830731 CTTGCTTCAGCCTCCTGAGTGGG - Intronic
1007486871 6:42186479-42186501 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1007568366 6:42870809-42870831 CTGGCCTCAGCCTCCTGAGTAGG - Intergenic
1007588705 6:43008502-43008524 CTTTTCTCTGCTGCCTGAGTTGG - Intronic
1007705118 6:43785747-43785769 CTTTTCTCTGCCTCCACAATGGG - Exonic
1007742233 6:44019585-44019607 TTTGCCTCAGCCTCCTGAGTAGG - Intergenic
1008668875 6:53746109-53746131 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1008681046 6:53872866-53872888 CTTGCCTCGGCCTCCAGAGTAGG + Intronic
1009721923 6:67482749-67482771 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1010148271 6:72698313-72698335 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1010217693 6:73419294-73419316 CCTGCCTCAGCCTCCTGATTGGG - Intronic
1010440234 6:75885422-75885444 CATGCCTCAGCCTCCTGAGTAGG - Intronic
1010691684 6:78918380-78918402 CTTGTCTCTGCCTCTTAAGTGGG - Intronic
1010876016 6:81106632-81106654 CCTGACTCAGCCTCCGGAATAGG + Intergenic
1011487064 6:87853789-87853811 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1011685698 6:89821665-89821687 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1011906739 6:92379584-92379606 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1011996090 6:93590090-93590112 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1012552584 6:100477626-100477648 CTTGCCTCAGCCTCCTGAGTAGG - Intergenic
1013100374 6:106981353-106981375 CTGGACTCTGCCTCCTGCACAGG - Intergenic
1013251081 6:108334117-108334139 CGTGCCTCAGCCTCCTGAGTAGG + Intronic
1013511076 6:110844667-110844689 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1013527641 6:110989735-110989757 CCTGCCTCAGCCTCCTGAGTTGG + Intronic
1013564788 6:111347155-111347177 CCTGTCTCAGCCTCCTGAGTAGG - Intronic
1013765751 6:113572370-113572392 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1014015788 6:116528438-116528460 CTTGTTTCTCCCCACTGAATAGG - Intronic
1014813429 6:125909696-125909718 CCTGACTCAGCCTCCTGACTAGG - Intronic
1015183340 6:130384421-130384443 CCTGTCTCAGCCTCCCGAGTAGG + Intronic
1015687094 6:135876745-135876767 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1015991172 6:138945120-138945142 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1016157503 6:140829782-140829804 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1016405350 6:143724241-143724263 CTTGCCTCAGCCTCCCGAGTAGG + Intronic
1016752773 6:147649677-147649699 CTTGCCTCAGCCTCCAGAGTAGG - Intronic
1016872072 6:148827502-148827524 CCTGCCTCAGCCTCCTGAGTTGG - Intronic
1016953645 6:149605878-149605900 CCTGTCTCAGCCTTCTGAGTAGG + Intronic
1016998123 6:149975376-149975398 CCTGTCTCAGCCTCCCGAGTAGG - Intergenic
1017033464 6:150245166-150245188 ACTGGCTCTGCCTCCTAAATGGG + Intronic
1017096325 6:150808639-150808661 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1017158994 6:151348039-151348061 CCTGTCTCAGCCTCCCGAGTAGG - Intronic
1017166749 6:151415679-151415701 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1017257242 6:152347790-152347812 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1017407985 6:154140440-154140462 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1017422119 6:154283178-154283200 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1017780960 6:157714929-157714951 CCTGCCTCAGCCTCCTGAGTGGG - Intronic
1017943134 6:159070934-159070956 CTTGTCTCTAACTCCTGACCTGG + Intergenic
1018211702 6:161488595-161488617 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1018479917 6:164180010-164180032 CTTGTCTCTGCGTCCTCACGAGG - Intergenic
1018483511 6:164215978-164216000 CCTGTCTCAGCCTCCTGAGTAGG + Intergenic
1018858515 6:167693154-167693176 CTTCCCTCAGCCTCCTGAGTAGG - Intergenic
1019245606 6:170707553-170707575 TTTCTCTCTGCCTCCTCACTTGG + Intergenic
1019380423 7:719149-719171 CCTGTCTCAGCCTCCCGAGTAGG + Intronic
1019468534 7:1204376-1204398 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1019484365 7:1282386-1282408 CCTGCCTCAGCCTCCCGAATAGG + Intergenic
1019521611 7:1463198-1463220 CCTGCCTCAGCCTCCTGGATAGG - Intergenic
1019628580 7:2034326-2034348 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1019650763 7:2156707-2156729 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1019757517 7:2783794-2783816 CTTGCCTCAGCCTCCCGAGTAGG + Intronic
1019805214 7:3118554-3118576 CCTGTCTCAGCCTCCTGAGTAGG + Intergenic
1019845991 7:3502359-3502381 CTTGCCTCAGCCTCCCGAGTAGG + Intronic
1020031973 7:4939849-4939871 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1020140954 7:5611392-5611414 CCTGCCTCAGCCTCCTGAGTGGG + Intergenic
1020232227 7:6328102-6328124 CCTGTCTCAGCCTCCCGAATAGG - Intergenic
1020249570 7:6456662-6456684 CTTGCCTCAGCCTCCCGAGTAGG + Intronic
1020671734 7:11123666-11123688 CCTGTCTCAGCCTCCCGAGTAGG - Intronic
1020779114 7:12496035-12496057 CTTGCCTCAGCCTCCAGAGTAGG + Intergenic
1020930495 7:14387299-14387321 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1021417636 7:20406436-20406458 CCTGCCTATGCCTCCTGAGTAGG - Intronic
1021445445 7:20728640-20728662 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1021708221 7:23389270-23389292 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1021720938 7:23503573-23503595 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1021982423 7:26067774-26067796 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1022085066 7:27058731-27058753 CCTGTCTCAGCCTCCCGAGTAGG + Intergenic
1022242305 7:28524391-28524413 CCTGCCTCAGCCTCCTGATTAGG - Intronic
1022249493 7:28593358-28593380 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1022479236 7:30732437-30732459 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1022940540 7:35232908-35232930 CTCGTGTCAGCCTCCTGAGTAGG - Intronic
1023014588 7:35954832-35954854 CCTGCCTCGGCCTCCTGAGTAGG - Intergenic
1023155736 7:37249965-37249987 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1023162628 7:37312202-37312224 CCTGCCTCAGCCTCCTGAGTGGG + Intronic
1023205873 7:37749380-37749402 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1023296271 7:38717967-38717989 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1023718455 7:43068199-43068221 CCTGCCTCAGCCTCCCGAATAGG + Intergenic
1023807424 7:43883470-43883492 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1023813127 7:43927549-43927571 CTTGCCTCTGCCTCCTAAAGTGG + Intronic
1023950655 7:44841619-44841641 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1023973622 7:45010707-45010729 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1023975259 7:45024469-45024491 CTTTTCTCTGCTTCCTGGGTTGG + Intronic
1024066406 7:45740172-45740194 CCTGCCTCGGCCTCCTGAGTAGG + Intergenic
1024237598 7:47409767-47409789 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1024338945 7:48237712-48237734 CCTGCCTCTGCCTCCTGAATTGG + Intronic
1024549850 7:50553596-50553618 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1025184789 7:56849305-56849327 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1025681960 7:63688063-63688085 CTTGCCTCAGCCTCCCGAGTAGG + Intergenic
1025687141 7:63727657-63727679 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1025728873 7:64092341-64092363 CCTGCCTCAGCTTCCTGAATAGG - Intronic
1025747524 7:64256807-64256829 CCTGTCTCAGCCTCCTGAGTAGG + Intronic
1025933133 7:66012270-66012292 CCTGCCTCTGCCTCCCGAGTAGG - Intergenic
1025963307 7:66244058-66244080 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1026149296 7:67774499-67774521 CCTGCCTCAGCCTCCTGACTGGG + Intergenic
1026246672 7:68626471-68626493 CCTGTCTCAGCCACCTGAGTAGG - Intergenic
1026329818 7:69342121-69342143 CCTGCCTCAGCCTCCTGAATGGG + Intergenic
1026465798 7:70653141-70653163 CCTGTCTCAGCCTCCTGAGTAGG - Intronic
1026581075 7:71617752-71617774 CCTGCCTCAGCCTCCCGAATAGG + Intronic
1026885674 7:73942634-73942656 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1026961637 7:74411975-74411997 CGTGCCTCAGCCTCCTGAGTAGG - Intergenic
1026996827 7:74622517-74622539 CCTGTCTCAGCCTCCTGAGTAGG - Intergenic
1027931504 7:84541637-84541659 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1027955462 7:84873541-84873563 CTTGCCTCTGCCTTCTAGATGGG - Intergenic
1028080886 7:86574144-86574166 CCTGTCTCAGCCTCCTGAGTAGG - Intergenic
1028151998 7:87384418-87384440 CGTGCCTCAGCCTCCTGAGTAGG - Intronic
1028544970 7:91987755-91987777 GATTTTTCTGCCTCCTGAATAGG - Intronic
1028599291 7:92583936-92583958 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1028611065 7:92712046-92712068 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1029040070 7:97563912-97563934 CTTGTCTCAGTCTCCCGAGTAGG - Intergenic
1029085498 7:98008513-98008535 CCTGCCTCAGCCTCCTGAGTGGG - Intergenic
1029099032 7:98112966-98112988 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1029134473 7:98359382-98359404 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1029334060 7:99885525-99885547 CCTGTCTCAGGCTCCTGAGTAGG - Intronic
1029356119 7:100053012-100053034 CATGCCTCAGCCTCCTGAGTAGG - Intronic
1029378072 7:100194057-100194079 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1029383405 7:100227826-100227848 CATGCCTCAGCCTCCTGAGTAGG - Intronic
1029433935 7:100551179-100551201 CCTGTCTCAGCCTCCCGAGTAGG + Intronic
1029560003 7:101296554-101296576 CTTGCCTCAGCCTCCTGAGTAGG + Intergenic
1029611391 7:101628342-101628364 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1029715893 7:102325472-102325494 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1029853737 7:103491715-103491737 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1029867516 7:103650735-103650757 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1030002371 7:105079244-105079266 CATGCCTCAGCCTCCCGAATAGG + Intronic
1030122476 7:106123564-106123586 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1030447359 7:109663926-109663948 CTTGTCTCTGCTTGCTTACTCGG - Intergenic
1030523085 7:110622095-110622117 CTTATCTCTTCCTCTTAAATGGG - Intergenic
1030529551 7:110695819-110695841 CTGTGCTCTGCCTCCTTAATTGG - Intronic
1030529618 7:110696536-110696558 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1030650650 7:112112530-112112552 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1031160739 7:118164924-118164946 CTTGCCTCATCCTCTTGAATGGG - Intergenic
1031371943 7:120978724-120978746 CCTGCCTCAGCCTCCCGAATAGG + Intergenic
1031455458 7:121973820-121973842 CATGCCTCAGCCTCCTGAGTAGG - Intronic
1031924908 7:127629987-127630009 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1032008559 7:128324896-128324918 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1032251524 7:130261937-130261959 CTTGCCTGAGCCTCCTGAGTAGG + Intergenic
1032378981 7:131455932-131455954 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1032720174 7:134544707-134544729 CGTGCCTCAGCCTCCTGAGTGGG - Intergenic
1032762140 7:134953362-134953384 CCTGTCTCAGGCTCCTGAGTAGG - Intronic
1033149549 7:138901435-138901457 CATGCCTCAGCCTCCTGAAGAGG + Intronic
1033172779 7:139098553-139098575 CCTGCCCCAGCCTCCTGAATAGG - Intronic
1033338835 7:140476358-140476380 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1033453828 7:141484671-141484693 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1033548846 7:142426799-142426821 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1034177827 7:149114168-149114190 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1034482569 7:151333802-151333824 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1034525516 7:151658044-151658066 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1034810897 7:154131005-154131027 CTTGGCTCCGGCTTCTGAATCGG - Intronic
1035196697 7:157227586-157227608 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1035351240 7:158247726-158247748 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1035429411 7:158807137-158807159 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1035502518 8:100649-100671 TTTCTCTCTGCCTCCTCACTTGG - Intergenic
1035536526 8:395346-395368 CTTGTCTGTGTCTCCAGATTTGG - Intergenic
1036132249 8:6126418-6126440 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1036160393 8:6382239-6382261 CCTGCCTCTGCCTCCTAAAGTGG - Intergenic
1036426609 8:8650461-8650483 CCTGTCTCAGCCTCCCGAGTAGG - Intergenic
1036458493 8:8930681-8930703 CCTGTCTCAGCCTCCTGAGTAGG + Intergenic
1036496926 8:9278181-9278203 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1036514679 8:9432888-9432910 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1036730341 8:11257447-11257469 TGTGCCTCAGCCTCCTGAATAGG + Intergenic
1036770498 8:11575430-11575452 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1036955007 8:13178458-13178480 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1037013114 8:13869692-13869714 CTTGCCTCACCCTCCTGAGTAGG + Intergenic
1037014548 8:13886285-13886307 CCTGTCTCAGCCTCCCGAGTAGG - Intergenic
1037105114 8:15097060-15097082 CCTGCCTCAGCCTCCTGAATAGG + Intronic
1037189994 8:16113059-16113081 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1037279311 8:17219136-17219158 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1037332905 8:17762165-17762187 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1037610967 8:20476002-20476024 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1037614337 8:20504071-20504093 CTTGCCTCAGCCTCCTGAGTAGG + Intergenic
1038008218 8:23452177-23452199 TTTGTCTCTTCCCCCAGAATGGG + Intronic
1038669436 8:29570660-29570682 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1038706478 8:29898615-29898637 CTTGTCTCTGTTTCCAGGATAGG + Intergenic
1038799378 8:30735443-30735465 CATGTCTCAGCCTCCTGAGTGGG - Intronic
1039152405 8:34521218-34521240 CCTGCCTCAGCCTCCTGACTAGG - Intergenic
1039304409 8:36246109-36246131 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1039516843 8:38140846-38140868 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1039551156 8:38443939-38443961 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1039558357 8:38493182-38493204 CCTGCCTCAGCCTCCCGAATAGG - Intergenic
1039694073 8:39891698-39891720 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1039857461 8:41428412-41428434 CCTGCCTCAGCCTCCTGAATAGG - Intergenic
1039904682 8:41777461-41777483 CTTGCCTCAGCCTCCTGGGTAGG - Intronic
1039982351 8:42418496-42418518 CCTGTCTCAGCCTCCTGAGTAGG + Intronic
1039991468 8:42491557-42491579 CTTGCCTCAGCCTCCCAAATAGG - Intronic
1040858275 8:51972747-51972769 CCTGCCTCGGCCTCCTGAATAGG - Intergenic
1041058322 8:54010925-54010947 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1041072449 8:54138427-54138449 CGTGCCTCAGCCTCCTGAGTAGG + Intronic
1041083612 8:54236560-54236582 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1041115765 8:54534875-54534897 CCTGTCTCAGCCTCCCGAGTAGG + Intergenic
1041329783 8:56712386-56712408 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1041560635 8:59214621-59214643 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1042166703 8:65952423-65952445 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1042176229 8:66039458-66039480 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1042220211 8:66466178-66466200 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1042601927 8:70507320-70507342 CTTGCCTCAGCCTCCTGAGTAGG + Intergenic
1042749715 8:72145061-72145083 CCTGTCTCAGCCTCCTGAGTAGG + Intergenic
1043393053 8:79809724-79809746 CCTGTTTCAGCCTCCTGAGTAGG + Intergenic
1043752779 8:83961255-83961277 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1043908766 8:85836472-85836494 CCTGCCTCAGCCTCCTGAATAGG + Intergenic
1044112371 8:88290687-88290709 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1044129754 8:88506508-88506530 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1044235658 8:89827142-89827164 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1044240021 8:89877865-89877887 CTTGCCTCAGCCTCCTGAGTAGG - Intergenic
1044448326 8:92303829-92303851 CTGGTCTCAGTCTCCTGACTAGG - Intergenic
1044474658 8:92612180-92612202 GTTGCCTCTGCCTCCTGCAGGGG - Intergenic
1044745377 8:95365723-95365745 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1044771302 8:95637657-95637679 CCTGCTTCGGCCTCCTGAATAGG - Intergenic
1044859816 8:96512054-96512076 CTTGACTCTGTCTCCTGGCTGGG - Intronic
1045038152 8:98193689-98193711 CGTGTCTCAGCCTCCCGAGTAGG - Intronic
1045462036 8:102433729-102433751 CCTGACTCAGCCTCCTGAGTAGG - Intergenic
1045524569 8:102930665-102930687 CCTGCCTCAGCCTTCTGAATAGG + Intronic
1045540439 8:103079281-103079303 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1045767680 8:105694096-105694118 CCTGCCTCTGCTTCCCGAATAGG + Intronic
1046003896 8:108456219-108456241 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1046507216 8:115151680-115151702 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1046508719 8:115171484-115171506 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1046574406 8:116008089-116008111 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1046742495 8:117844262-117844284 CCTGTCTCAGCCTCCTGAGTAGG + Intronic
1046863595 8:119121447-119121469 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1047062609 8:121245123-121245145 CTTTTCTTTGCCTTCTGAAACGG - Intergenic
1047073458 8:121373658-121373680 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1047256851 8:123220327-123220349 CATGTCTCTGCCTCTTTTATTGG - Intronic
1047269150 8:123338241-123338263 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1047483740 8:125309133-125309155 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1047649916 8:126909518-126909540 CTTGCCTCAGCCTCCTGAGTAGG + Intergenic
1047738870 8:127790925-127790947 CTTGCCTCAGCCTCCTGAGTGGG - Intergenic
1047764694 8:127980906-127980928 CTTGCCTCAGCCTCTTGAGTAGG + Intergenic
1048672323 8:136736905-136736927 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1048887604 8:138920862-138920884 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1048917403 8:139198208-139198230 GCTGCCTCAGCCTCCTGAATAGG - Intergenic
1049117358 8:140700720-140700742 CTTGCCTCAGCCTCCCAAATAGG + Intronic
1049393384 8:142383335-142383357 CTTGTCTCTGGGCCCTGAAGTGG - Intronic
1049610265 8:143551947-143551969 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1049733455 8:144191179-144191201 CATGCCTCAGCCTCCTGAGTAGG + Intronic
1049779232 8:144420577-144420599 CCTGCCTCAGCCTCCTGAATAGG - Intergenic
1049819962 8:144627441-144627463 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1050499991 9:6287445-6287467 CATGTCTCAGCCTCCCAAATGGG - Intergenic
1050534001 9:6615468-6615490 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1050539966 9:6661247-6661269 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1050964721 9:11784465-11784487 CTTGCCTCAGTCTCCTGAGTAGG + Intergenic
1051105566 9:13575717-13575739 CTTGCCACTGCCTTCTGAAAAGG + Intergenic
1051119210 9:13733657-13733679 CCTGCCTCAGCCTCCTGAGTTGG + Intergenic
1051237099 9:15012936-15012958 CCCGTCTCGGCCTCCTGAGTAGG + Intergenic
1051275769 9:15396481-15396503 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1051367480 9:16331480-16331502 CTTCTCTCTGTCTCCTGCTTTGG - Intergenic
1051624420 9:19085037-19085059 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1051984946 9:23073107-23073129 CTTGTCTCCACTTTCTGAATTGG + Intergenic
1052194970 9:25701244-25701266 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1052242634 9:26292789-26292811 CTTATCTAGGCCTCCTGAGTAGG + Intergenic
1052366822 9:27621128-27621150 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1052580914 9:30352603-30352625 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1052618303 9:30871893-30871915 CCTGTCTCAGCCTCCTGAGTAGG - Intergenic
1053262336 9:36679184-36679206 CCTGTCTCTGCCTCCCAAGTAGG - Intergenic
1053617189 9:39780610-39780632 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1053897270 9:42754655-42754677 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1054195151 9:62024065-62024087 CTTGCCTTAGCCTCCTGAGTAGG + Intergenic
1054266978 9:62926827-62926849 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1054550471 9:66596278-66596300 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1054643257 9:67564624-67564646 CTTGCCTTAGCCTCCTGAGTAGG - Intergenic
1054725059 9:68641784-68641806 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1054849051 9:69827722-69827744 GGTGTCTCTGCCTCCAGATTCGG + Intronic
1055128487 9:72747705-72747727 CCTGACTCAGCCTCCTGAGTAGG + Intronic
1055298664 9:74860468-74860490 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1055315608 9:75030591-75030613 CTTGACTCTGTCTCCTAACTTGG + Intergenic
1055980687 9:81997117-81997139 CCTGCCTCAGCCTCCTGCATAGG + Intergenic
1056257671 9:84816665-84816687 CCTGCCTCAGCCTCCTGAATAGG - Intronic
1056304782 9:85279282-85279304 CCTGCCTCAGCCTCCCGAATAGG - Intergenic
1056620012 9:88204515-88204537 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1056636758 9:88337633-88337655 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1056657715 9:88522833-88522855 CCTGCCTCAGCCTCCTGAGTGGG + Intergenic
1057789311 9:98112865-98112887 CCTGTCTCGGCCTCCTAAAGTGG - Intronic
1057935678 9:99236755-99236777 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1058102758 9:100935573-100935595 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1058120193 9:101129717-101129739 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1058134034 9:101287610-101287632 CCTGTCTCAGCCTCCTGAGTAGG + Intronic
1058254082 9:102738958-102738980 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1058389011 9:104473188-104473210 CCTGTCTCAGCCTCCTGAGTAGG + Intergenic
1058470938 9:105278171-105278193 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1058590555 9:106560351-106560373 CTTGTCTCAGCCTCCCGAGCAGG - Intergenic
1058660249 9:107259951-107259973 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1058665969 9:107316119-107316141 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1058696144 9:107560607-107560629 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1058890667 9:109358071-109358093 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1058936388 9:109773245-109773267 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1059055420 9:110974045-110974067 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1059184972 9:112260017-112260039 CCTGCCTCAGCCTCCAGAATAGG + Intronic
1059560522 9:115330392-115330414 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1059845479 9:118270869-118270891 CATGCCTCAGCCTCCTGAGTAGG + Intergenic
1060097946 9:120810395-120810417 TCTGTCTCAGCCTCCTGAGTAGG + Intergenic
1060120492 9:120984831-120984853 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1060157981 9:121333250-121333272 CCTGTCTCAGCCTCCCGAGTAGG - Intergenic
1060287569 9:122267267-122267289 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1060445050 9:123680153-123680175 CTTTTCTCTGTCTTCTGATTGGG - Intronic
1060494038 9:124104991-124105013 CTTTCCTCAGCCTCCTGAGTAGG + Intergenic
1060614431 9:124998731-124998753 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1060639431 9:125226203-125226225 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1060716901 9:125940068-125940090 CCTGCCTCAGCCTCCCGAATAGG - Intronic
1060807152 9:126585003-126585025 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1060839199 9:126781026-126781048 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1060888302 9:127171645-127171667 CTTGCCTCAGCCTCCCGAGTAGG - Intronic
1061112889 9:128587955-128587977 CCTGACTCAGCCTCCTGAGTAGG + Intronic
1061171817 9:128962045-128962067 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1061362346 9:130151654-130151676 CCTGCCTCAGCCTCCTGAAGTGG + Intergenic
1061367400 9:130179044-130179066 CCTGTCTCAGCCTCCCGAGTAGG + Intronic
1061771833 9:132930474-132930496 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1061819233 9:133216386-133216408 CTTATCTCAGCCACCTTAATAGG - Intergenic
1061918956 9:133771775-133771797 TATGTCCCAGCCTCCTGAATTGG - Intronic
1061944030 9:133898480-133898502 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1061980015 9:134096999-134097021 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1062159565 9:135072800-135072822 CCTGCCTCAGCCTCCTGACTAGG + Intergenic
1062241454 9:135541824-135541846 CTTATCTCAGCCACCTTAATAGG + Intergenic
1062659830 9:137624109-137624131 CCTGGCTCAGCCTCCTGAGTAGG + Intronic
1203362258 Un_KI270442v1:226813-226835 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1203547545 Un_KI270743v1:139709-139731 CTTTTCTCTTCCTCCTGGCTTGG - Intergenic
1203605805 Un_KI270748v1:56760-56782 TTTCTCTCTGCCTCCTCACTTGG + Intergenic
1203662276 Un_KI270753v1:56595-56617 CTTGTCTCTTCCTCTTGACTTGG - Intergenic
1185481130 X:447185-447207 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1185493976 X:540382-540404 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1185584330 X:1233784-1233806 CCTGTCTCAGCCTCCCGAGTAGG - Intergenic
1185588051 X:1255074-1255096 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1185589949 X:1269509-1269531 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1185612995 X:1403120-1403142 CCTGTCTCTGCCTCCTCCATAGG - Exonic
1185614929 X:1415050-1415072 CCTGCCTCAGCCTCCTGAATAGG + Intronic
1185646602 X:1620281-1620303 CCTGCCTCAGCCTCCCGAATAGG + Intronic
1185782926 X:2864872-2864894 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1185791873 X:2933248-2933270 CCTGTCTCAGCCTCCCGAGTAGG - Intergenic
1186005859 X:5071124-5071146 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1186022904 X:5276317-5276339 CCTGTCTCAGCCTCCTGAACAGG - Intergenic
1186169357 X:6860581-6860603 CTTGCCTCAGCCTCCCGAGTAGG + Intergenic
1186353456 X:8764470-8764492 CTTGTCTCTGCCTCTTGGAGAGG - Intergenic
1186364535 X:8877430-8877452 CTTGTCACTGCCTCCTGCAGAGG - Intergenic
1186374347 X:8982174-8982196 TTTGTCTCAGCCTCCTGGAAAGG - Intergenic
1186526991 X:10257884-10257906 TTTGTCTCAGCCTCCTTGATGGG - Intergenic
1186664060 X:11700607-11700629 CTTGTCATTGACTCCTAAATAGG + Intergenic
1186711874 X:12206399-12206421 GTTGGCTCTGCCTCATGACTTGG - Intronic
1186794698 X:13033595-13033617 CTTGCCTCTGCCTCTTGGAGAGG - Intergenic
1186879405 X:13849945-13849967 CCTGCCTCAGCCTCCTGAGTTGG - Intronic
1187341194 X:18423437-18423459 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1187538111 X:20162733-20162755 CTCACCTCAGCCTCCTGAATAGG - Intronic
1187851980 X:23600003-23600025 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1187860824 X:23680797-23680819 CTTATCTCAGCCTCTTGAGTAGG - Intronic
1187947573 X:24441429-24441451 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1188115856 X:26241185-26241207 CATGCCTCAGCCTCCTGAGTAGG - Intergenic
1188493954 X:30764348-30764370 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1188695256 X:33182374-33182396 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1188740787 X:33778137-33778159 CTTGCCTTAGCCTCCTGAGTGGG + Intergenic
1188827606 X:34855535-34855557 CCTGGCTCTGCCTCCCAAATAGG + Intergenic
1189106728 X:38244389-38244411 CCTGTCTCAGCCTCCCGAGTAGG - Intronic
1189339566 X:40194490-40194512 CCTGTCTCAGCCTCCTGAGTAGG + Intergenic
1189372006 X:40436109-40436131 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1189384724 X:40528058-40528080 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1189390026 X:40568808-40568830 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1189580992 X:42406260-42406282 CCTGTCTCAGCCTCCCGAGTAGG - Intergenic
1189784989 X:44551289-44551311 CCTGTCTCAGCCTCCTGAGTAGG + Intergenic
1189827124 X:44931174-44931196 CCTGCCTCAGCCTCCTGAGTAGG + Intronic
1189846013 X:45139171-45139193 CTTGCCTCAGCCTCCTGAGTAGG + Intergenic
1190023662 X:46902850-46902872 CGTGCCTCAGCCTCCTGAGTAGG - Intergenic
1190085096 X:47388561-47388583 CCTGCCTCAGCCTCCTGAGTTGG + Intronic
1190161403 X:48034049-48034071 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1190239268 X:48644712-48644734 CTTGCCTCCACCTCCTGAGTAGG + Intergenic
1190246490 X:48694191-48694213 CCTGCCTCTGCCTCCTGAGTAGG - Intergenic
1190527126 X:51339459-51339481 GTTGTCTCTGTGTCCTGAGTCGG + Intergenic
1190940448 X:55035292-55035314 GCTTTCTCTGCCTGCTGAATAGG - Intergenic
1191817958 X:65269609-65269631 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1192006062 X:67213743-67213765 CCTGTCTCAGCCTCCTGAGTAGG - Intergenic
1192337977 X:70237718-70237740 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1192448854 X:71230329-71230351 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1192488532 X:71552498-71552520 CTTGCCTCAGCCTCCGGAGTAGG + Intronic
1192627488 X:72745353-72745375 CGTGTCTCAGCCTCCTGGGTAGG - Intergenic
1192654220 X:72975460-72975482 CGTGTCTCAGCCTCCTGGGTAGG + Intergenic
1192841623 X:74863058-74863080 CATGCCTCAGCCTCCCGAATAGG - Intronic
1192859569 X:75052353-75052375 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1192965207 X:76169888-76169910 CCTGCCTCAGCCTCCCGAATAGG - Intergenic
1194013931 X:88596637-88596659 CCTGTCTCAACCTCCTGAGTAGG + Intergenic
1194213031 X:91092261-91092283 CTTGTCTCTGGCTTCAGAGTGGG + Intergenic
1194392549 X:93338143-93338165 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1194439237 X:93909912-93909934 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1194671982 X:96745116-96745138 CCTGTCTCAGCCTCCCGAGTAGG + Intronic
1194706462 X:97181179-97181201 CTTGTTTCAGCCTCCCGAGTGGG + Intronic
1194716490 X:97292138-97292160 CCTGCCTCAGCCTCCTGAATAGG + Intronic
1195044894 X:101046812-101046834 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1195262390 X:103145569-103145591 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1195542465 X:106078358-106078380 CATGCCTCAGCCTCCTGAGTAGG - Intergenic
1195692502 X:107638842-107638864 CGTGCCTCAGCCTCCTGAGTAGG + Intronic
1195700747 X:107703812-107703834 CCTGTCTCAGCCTCCTGAGTAGG + Intergenic
1195881490 X:109597306-109597328 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1196280386 X:113817308-113817330 CCTGCCTCAGCCTCCGGAATAGG + Intergenic
1196701913 X:118679036-118679058 CCTGTCTTAGCCTCCTGAATAGG + Intronic
1197208964 X:123813837-123813859 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1198211883 X:134523922-134523944 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1198238884 X:134763707-134763729 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1198554028 X:137774035-137774057 CTTGCCTCAGCCTCCCGAGTAGG + Intergenic
1198628369 X:138605064-138605086 CCTGCCTCAGCCTCCCGAATAGG - Intergenic
1198729169 X:139708848-139708870 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1199267369 X:145844214-145844236 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1199443442 X:147895247-147895269 CCTGCCTCAACCTCCTGAATTGG - Intergenic
1199935119 X:152565819-152565841 CTTGTTTTTGCCTTCTGAAGAGG - Intergenic
1200130627 X:153842484-153842506 CCTGTCTCAGCCTCCCGAGTAGG + Intergenic
1200277190 X:154745218-154745240 CCTGCCTCAGCCTCCTGAGTAGG - Intronic
1200750481 Y:6940148-6940170 CTTGCCTCGGCCTCATGAATAGG - Intronic
1200862388 Y:8006761-8006783 TTTGGCTCTGCCTAATGAATTGG + Intergenic
1200984346 Y:9290128-9290150 CTTGTGCCTGCCTCATGAATGGG - Intergenic
1201281694 Y:12348138-12348160 CCTGTCTCAGCCTCCTGAGTAGG - Intergenic
1201353093 Y:13067959-13067981 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1201465544 Y:14276314-14276336 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1201477553 Y:14399432-14399454 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1201562761 Y:15335015-15335037 CTTGCCTCAACCTCCTGAGTAGG + Intergenic
1201646259 Y:16235737-16235759 CCTGCCTCAGCCTCTTGAATAGG + Intergenic
1201656554 Y:16349580-16349602 CCTGCCTCAGCCTCTTGAATAGG - Intergenic
1201677478 Y:16603626-16603648 CCTGCCTCAGCCTCCAGAATAGG + Intergenic
1201713187 Y:17014440-17014462 CCTGACTCAGCCTCCTGAGTAGG - Intergenic
1201894814 Y:18982107-18982129 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1201901804 Y:19051241-19051263 TTTGTCTCAGTCTCCTGAGTAGG + Intergenic
1201920621 Y:19229872-19229894 CCTGCCTCAGCCTCCTGAGTAGG + Intergenic
1201992028 Y:20037474-20037496 CCTGTCTCAGCCTCCCGAGTTGG - Intergenic
1202033980 Y:20612229-20612251 CCTGCCTCAGCCTCCTGAGTAGG - Intergenic
1202384300 Y:24309936-24309958 GTTGCCTCAGCCTCCTGAAGTGG + Intergenic
1202387979 Y:24343198-24343220 TTTCTCTCTGCCTCCTCACTTGG + Intergenic
1202482808 Y:25326930-25326952 TTTCTCTCTGCCTCCTCACTTGG - Intergenic
1202486484 Y:25360186-25360208 GTTGCCTCAGCCTCCTGAAGTGG - Intergenic