ID: 936425654

View in Genome Browser
Species Human (GRCh38)
Location 2:112415788-112415810
Sequence CAAGAGAATCACTTGAACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 527344
Summary {0: 1769, 1: 42452, 2: 114404, 3: 164204, 4: 204515}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936425648_936425654 27 Left 936425648 2:112415738-112415760 CCAGGTGTGGTGTCGGGCACATG 0: 3
1: 36
2: 2190
3: 13578
4: 42685
Right 936425654 2:112415788-112415810 CAAGAGAATCACTTGAACCCAGG 0: 1769
1: 42452
2: 114404
3: 164204
4: 204515
936425653_936425654 -4 Left 936425653 2:112415769-112415791 CCTATTCAGGAGGCAGAGACAAG 0: 7
1: 1
2: 18
3: 235
4: 1701
Right 936425654 2:112415788-112415810 CAAGAGAATCACTTGAACCCAGG 0: 1769
1: 42452
2: 114404
3: 164204
4: 204515
936425651_936425654 0 Left 936425651 2:112415765-112415787 CCCACCTATTCAGGAGGCAGAGA 0: 5
1: 11
2: 757
3: 15795
4: 133194
Right 936425654 2:112415788-112415810 CAAGAGAATCACTTGAACCCAGG 0: 1769
1: 42452
2: 114404
3: 164204
4: 204515
936425652_936425654 -1 Left 936425652 2:112415766-112415788 CCACCTATTCAGGAGGCAGAGAC 0: 7
1: 9
2: 564
3: 12266
4: 116813
Right 936425654 2:112415788-112415810 CAAGAGAATCACTTGAACCCAGG 0: 1769
1: 42452
2: 114404
3: 164204
4: 204515

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936425654 Original CRISPR CAAGAGAATCACTTGAACCC AGG Intronic
Too many off-targets to display for this crispr