ID: 936425655

View in Genome Browser
Species Human (GRCh38)
Location 2:112415791-112415813
Sequence GAGAATCACTTGAACCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 533837
Summary {0: 21628, 1: 64917, 2: 122797, 3: 157734, 4: 166761}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936425651_936425655 3 Left 936425651 2:112415765-112415787 CCCACCTATTCAGGAGGCAGAGA 0: 5
1: 11
2: 757
3: 15795
4: 133194
Right 936425655 2:112415791-112415813 GAGAATCACTTGAACCCAGGAGG 0: 21628
1: 64917
2: 122797
3: 157734
4: 166761
936425648_936425655 30 Left 936425648 2:112415738-112415760 CCAGGTGTGGTGTCGGGCACATG 0: 3
1: 36
2: 2190
3: 13578
4: 42685
Right 936425655 2:112415791-112415813 GAGAATCACTTGAACCCAGGAGG 0: 21628
1: 64917
2: 122797
3: 157734
4: 166761
936425653_936425655 -1 Left 936425653 2:112415769-112415791 CCTATTCAGGAGGCAGAGACAAG 0: 7
1: 1
2: 18
3: 235
4: 1701
Right 936425655 2:112415791-112415813 GAGAATCACTTGAACCCAGGAGG 0: 21628
1: 64917
2: 122797
3: 157734
4: 166761
936425652_936425655 2 Left 936425652 2:112415766-112415788 CCACCTATTCAGGAGGCAGAGAC 0: 7
1: 9
2: 564
3: 12266
4: 116813
Right 936425655 2:112415791-112415813 GAGAATCACTTGAACCCAGGAGG 0: 21628
1: 64917
2: 122797
3: 157734
4: 166761

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936425655 Original CRISPR GAGAATCACTTGAACCCAGG AGG Intronic
Too many off-targets to display for this crispr