ID: 936425656

View in Genome Browser
Species Human (GRCh38)
Location 2:112415797-112415819
Sequence CACTTGAACCCAGGAGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363744
Summary {0: 9186, 1: 33764, 2: 74834, 3: 112568, 4: 133392}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936425652_936425656 8 Left 936425652 2:112415766-112415788 CCACCTATTCAGGAGGCAGAGAC 0: 7
1: 9
2: 564
3: 12266
4: 116813
Right 936425656 2:112415797-112415819 CACTTGAACCCAGGAGGCAGAGG 0: 9186
1: 33764
2: 74834
3: 112568
4: 133392
936425653_936425656 5 Left 936425653 2:112415769-112415791 CCTATTCAGGAGGCAGAGACAAG 0: 7
1: 1
2: 18
3: 235
4: 1701
Right 936425656 2:112415797-112415819 CACTTGAACCCAGGAGGCAGAGG 0: 9186
1: 33764
2: 74834
3: 112568
4: 133392
936425651_936425656 9 Left 936425651 2:112415765-112415787 CCCACCTATTCAGGAGGCAGAGA 0: 5
1: 11
2: 757
3: 15795
4: 133194
Right 936425656 2:112415797-112415819 CACTTGAACCCAGGAGGCAGAGG 0: 9186
1: 33764
2: 74834
3: 112568
4: 133392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936425656 Original CRISPR CACTTGAACCCAGGAGGCAG AGG Intronic
Too many off-targets to display for this crispr