ID: 936428058

View in Genome Browser
Species Human (GRCh38)
Location 2:112436078-112436100
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 3, 1: 0, 2: 0, 3: 13, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936428055_936428058 -8 Left 936428055 2:112436063-112436085 CCTTCTAGGCCACCTGCACACTT 0: 3
1: 0
2: 0
3: 7
4: 148
Right 936428058 2:112436078-112436100 GCACACTTCCTTGCAAAATCCGG 0: 3
1: 0
2: 0
3: 13
4: 128
936428053_936428058 0 Left 936428053 2:112436055-112436077 CCCTTGAACCTTCTAGGCCACCT 0: 1
1: 2
2: 1
3: 18
4: 108
Right 936428058 2:112436078-112436100 GCACACTTCCTTGCAAAATCCGG 0: 3
1: 0
2: 0
3: 13
4: 128
936428051_936428058 15 Left 936428051 2:112436040-112436062 CCAAACTCTATCAGGCCCTTGAA 0: 1
1: 2
2: 0
3: 15
4: 140
Right 936428058 2:112436078-112436100 GCACACTTCCTTGCAAAATCCGG 0: 3
1: 0
2: 0
3: 13
4: 128
936428054_936428058 -1 Left 936428054 2:112436056-112436078 CCTTGAACCTTCTAGGCCACCTG 0: 1
1: 2
2: 1
3: 12
4: 136
Right 936428058 2:112436078-112436100 GCACACTTCCTTGCAAAATCCGG 0: 3
1: 0
2: 0
3: 13
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901031488 1:6309565-6309587 GAATACTTCCTATCAAAATCGGG - Intronic
903558287 1:24209189-24209211 GAACACTTCATTGCTAAATTCGG - Intergenic
905459836 1:38115246-38115268 CCACATTTCCTGGCAAATTCTGG - Intergenic
907350976 1:53830531-53830553 CAACACTTCCTTGTAAAATCTGG - Intronic
909563575 1:77030903-77030925 TTACAATTCCTTGCCAAATCTGG + Intronic
910542024 1:88370421-88370443 TCATACTTCATTGCAAAATTAGG - Intergenic
917053105 1:170947537-170947559 TCACACTGTCTTGCAGAATCTGG - Exonic
919863131 1:201756378-201756400 TCATACTTCCTTGCTAATTCTGG + Intronic
922231832 1:223693908-223693930 GGACTCTCCCTGGCAAAATCTGG + Intergenic
923318128 1:232801535-232801557 ACAGACTTCCTTGCTTAATCAGG - Intergenic
923819721 1:237425276-237425298 GCACACAACCTTGCAACATGGGG + Intronic
924131093 1:240909063-240909085 GCACACGTCCTTGGATAATTGGG + Intronic
924505873 1:244683240-244683262 GTACACGTACTTGTAAAATCAGG - Intronic
1063799945 10:9563939-9563961 GCACACTTCTATGCAGAATTTGG - Intergenic
1070922778 10:80198718-80198740 TCACTCTTTCTTGAAAAATCAGG - Intronic
1071278595 10:84078845-84078867 GGACACATCCTGGCAACATCTGG - Intergenic
1073531531 10:104237011-104237033 GCGCCCTTCCTTGTAAGATCCGG + Intronic
1074047097 10:109849203-109849225 GGACACATCCTTGCATAACCTGG - Intergenic
1074938475 10:118211115-118211137 GCACTATGCCTTCCAAAATCAGG - Intergenic
1076324365 10:129609574-129609596 ACCCACTTCTTTGCAAACTCTGG + Intronic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1078339312 11:10487625-10487647 GCCCTCTTCCTTGGAAAATAGGG + Intronic
1081267391 11:41042532-41042554 GCACACTTCCTTGCCGCAACTGG + Intronic
1085715426 11:78868726-78868748 GCACACTTCCCTTCCAAAACTGG + Intronic
1086201895 11:84213296-84213318 GCTCACATCCTAGCAAAGTCAGG - Intronic
1087096625 11:94325435-94325457 CCTCACTTCCTAGCAGAATCAGG - Intergenic
1089319541 11:117615646-117615668 ACACACTTCCTTCTACAATCTGG - Intronic
1090772159 11:129930861-129930883 GAACACTTTCTTTCAAAATAAGG + Intronic
1093148751 12:15597631-15597653 GCAGAGTTTCTTGCAAGATCTGG + Intergenic
1094675871 12:32619889-32619911 TCACACTGCTTTCCAAAATCAGG + Intronic
1097458256 12:59828374-59828396 GTAACCTTCCTTGCAAAAACAGG + Intergenic
1099066502 12:77986651-77986673 GCAGACTTCCATGCAAAATGTGG - Intronic
1100400643 12:94226235-94226257 CCACTCTGCCTTCCAAAATCAGG - Intronic
1101181316 12:102221403-102221425 GCCCACAGCCTTCCAAAATCCGG - Intergenic
1102487566 12:113268590-113268612 TCACACTTCCTGCCAACATCAGG - Intronic
1106088765 13:26567443-26567465 ACAATTTTCCTTGCAAAATCAGG - Intronic
1106948293 13:34853515-34853537 GTGCACTTCCTTGTAAAATACGG - Intergenic
1106981791 13:35293756-35293778 GGAGACTTCCTTAAAAAATCTGG - Intronic
1109372793 13:61445954-61445976 TCATTCTTCCTTGCAAGATCTGG + Intergenic
1109603195 13:64659454-64659476 GCAAACTTGCTGGCAAAAGCAGG - Intergenic
1113781797 13:112981503-112981525 GCACACTTCCTTACAGGATGGGG - Intronic
1118368135 14:65113111-65113133 GTGCACTTCCTTGTAAAATCCGG - Intergenic
1118395484 14:65332679-65332701 GCTCACTTCCTTGTAACAACAGG - Intergenic
1119889182 14:78169964-78169986 TTGCTCTTCCTTGCAAAATCAGG - Intergenic
1119962077 14:78870165-78870187 GTGCACTTCCTTGTAAAATCTGG - Intronic
1121852312 14:97232897-97232919 GCACACATTCTTCCAAAATCAGG - Intergenic
1130697532 15:86145575-86145597 GCACTCTTCCTTCCAATATTTGG + Intronic
1134179977 16:12039743-12039765 TCACACTGCCCTGCAAAATGAGG - Intronic
1135306724 16:21373510-21373532 TCACACTGCCCTGCAAAATGAGG - Intergenic
1136303465 16:29352652-29352674 TCACACTGCCCTGCAAAATGAGG - Intergenic
1137661164 16:50207883-50207905 GCACAGTGCCTTGCATATTCAGG - Intronic
1139325479 16:66149780-66149802 GCAAATTTCTTTGCAAATTCTGG - Intergenic
1139767165 16:69240601-69240623 ACAAACTTGCTTGCAAAAGCAGG + Intronic
1142286708 16:89174398-89174420 GCACCCTTCCTTGGAAAACCGGG + Intronic
1144377202 17:14656251-14656273 ACAGAATTCCTTGAAAAATCAGG - Intergenic
1145006053 17:19338433-19338455 GCACACTTCCATCAAAAATGTGG + Intronic
1147493600 17:40894984-40895006 CAACTCTTCCTTGCAAAATTAGG - Intergenic
1147904151 17:43812171-43812193 GCACACTTCTGAGGAAAATCAGG + Intronic
1148940272 17:51203302-51203324 ACAAATTTCCTTGCAAAGTCAGG + Intronic
1155260661 18:24039069-24039091 GCACAGTTCCTGGCAAACTGGGG - Intronic
1155295565 18:24381389-24381411 GTGCACTTCCTTGTAAAATCCGG - Intronic
1155332551 18:24732764-24732786 GCACAGATCCTTGCAAATGCTGG + Intergenic
1155822819 18:30399384-30399406 GCAGACTTCCTTCCACAATGTGG - Intergenic
1155986427 18:32235355-32235377 GCAAAATTCCATGCAAAATGTGG - Intronic
1165675407 19:37718631-37718653 GTACACTTCACTGTAAAATCTGG + Intronic
925517735 2:4703539-4703561 AAACACTTACTTCCAAAATCTGG - Intergenic
926798674 2:16640133-16640155 ACACACATCCTTGCAAAAAGGGG + Intronic
930910678 2:56625841-56625863 GAACACTTGCTTCCATAATCTGG + Intergenic
931218575 2:60268362-60268384 GCACACTCAGTTGCAAAATGAGG + Intergenic
932161603 2:69465438-69465460 GCACCCTTCCCTTCAAAATCAGG - Intronic
936428058 2:112436078-112436100 GCACACTTCCTTGCAAAATCCGG + Intergenic
938926153 2:136044340-136044362 GTACATTTCCTTGAAAAGTCTGG + Intergenic
938979425 2:136511695-136511717 TCAGTCTTCCTTGCAAAATCAGG - Intergenic
940333798 2:152503503-152503525 ATACACTTCCTTATAAAATCTGG - Intronic
941287355 2:163630645-163630667 GTACAAATCCTTGCTAAATCTGG - Intronic
947488450 2:230573680-230573702 GGCCACTGCCTTGCAAAAGCTGG - Intergenic
1169715790 20:8616220-8616242 CCTTACTTCCTTGCAGAATCTGG + Intronic
1170499125 20:16956699-16956721 GCACAATTTTTTGGAAAATCAGG - Intergenic
1170947433 20:20903856-20903878 GCAAATTTCTATGCAAAATCTGG + Intergenic
1171057410 20:21920910-21920932 GCACACTTTCTTGCACAAGGTGG + Intergenic
1171464722 20:25319502-25319524 GCACACTTCCTGGAAAAAAGTGG - Intronic
1173995628 20:47336617-47336639 GCACAATTCATTGCAGAATTTGG - Intronic
1174328637 20:49799958-49799980 CCACACTTCGTTGAAAAATTGGG + Intergenic
1176374196 21:6079134-6079156 GCACACTTCCTTGCAAAATCCGG - Intergenic
1179749280 21:43459111-43459133 GCACACTTCCTTGCAAAATCCGG + Intergenic
1179833660 21:44013498-44013520 GCACTCTCTGTTGCAAAATCTGG + Intronic
1180901293 22:19375303-19375325 GCTCTCTTCCGTGCAAACTCTGG + Intronic
1181742894 22:24935525-24935547 GCACACTTCCTTGATGAATGGGG + Exonic
1183815956 22:40300700-40300722 CCACACTTCTTTGCAAACTATGG + Intronic
1184540492 22:45120484-45120506 GCCCATTTCTTTGGAAAATCTGG + Intergenic
951128750 3:19016034-19016056 GCACTCTTACTTGTAAAACCTGG - Intergenic
952504825 3:33998364-33998386 CCACACTTCCTTGCACACCCTGG - Intergenic
952650683 3:35723243-35723265 CCCCACCTCCATGCAAAATCTGG + Intronic
961765515 3:129207477-129207499 GCACATTTGTTTGCAAAATCAGG - Intergenic
962158303 3:132972621-132972643 GCACAATTTCTTTCATAATCTGG + Intergenic
964442001 3:156721440-156721462 GCACATTTGCCTGCAAAAGCAGG + Intergenic
965869786 3:173252128-173252150 GCACATTACCTGGCAAAAGCAGG + Intergenic
970038556 4:11769673-11769695 GCTCACTTCCTTGAAATATGGGG - Intergenic
971563517 4:28112755-28112777 CCACACTTCCTTGGAAACTGAGG - Intergenic
975280976 4:72561931-72561953 GTAAACTTCTTTGGAAAATCAGG + Intronic
981616837 4:146651288-146651310 TCACATTTCCTTTCAAAACCAGG + Intergenic
981617483 4:146656373-146656395 GCAAGCCTCCTTGAAAAATCTGG - Intergenic
981945196 4:150334564-150334586 GAACACTTGCATGCAAAATCTGG + Intronic
984305540 4:177984646-177984668 GCACATTTCCATTCAAAACCTGG - Intronic
990865665 5:60377074-60377096 GCACACTTCCTGGTAAACACAGG + Intronic
993701535 5:91124669-91124691 GCAAACTTCCTGGTAAAATGTGG + Intronic
993786602 5:92146586-92146608 TAACATTACCTTGCAAAATCAGG - Intergenic
994665888 5:102704934-102704956 GCACAGTGCCTTACAAAATGGGG + Intergenic
996804927 5:127443906-127443928 GCACATGTCCATGCAAAAACTGG - Intronic
997491108 5:134276906-134276928 GTACTCTGCCTTGCAAATTCTGG + Intergenic
1003525912 6:6897277-6897299 GCAAACATCCTTGCAAAGTTTGG - Intergenic
1005498648 6:26411319-26411341 GCACACCCCCTTGCAAAGCCTGG + Intronic
1007946423 6:45831199-45831221 GCACACTGCTTTGCAACAGCAGG + Intergenic
1008837291 6:55850085-55850107 TCACCTTTCCTTGAAAAATCTGG + Intronic
1012888957 6:104877462-104877484 GCACATTTCCTTCCAGAAACAGG - Intergenic
1015193412 6:130497700-130497722 GCACAATTCCTTCTAAAATATGG - Intergenic
1015647392 6:135408364-135408386 TCAGACTTCCTTTTAAAATCTGG + Intronic
1017789123 6:157780198-157780220 GCTTACTTCATTGCAAAATGAGG + Intronic
1018197769 6:161369544-161369566 CCACACTTTATTGCACAATCGGG - Intronic
1021548351 7:21841672-21841694 GCACACTACCCTGGAAACTCAGG - Intronic
1022449119 7:30497859-30497881 TCACACTGCCTTTCAGAATCAGG - Intronic
1022632163 7:32095450-32095472 GCAGCCTTCCTTGCTAAAACTGG + Intronic
1030013771 7:105197934-105197956 GAACATTGCCTTGCAATATCAGG - Intronic
1033637791 7:143228040-143228062 TCACACTTCATTGCAAAACCAGG + Intergenic
1034883074 7:154777219-154777241 CCACACTTCCATGCAGACTCTGG - Intronic
1037158687 8:15739640-15739662 GCAAACTTATTTGTAAAATCTGG + Intronic
1037425825 8:18753455-18753477 AAATACTTCCTTGCAAGATCTGG + Intronic
1042848220 8:73189578-73189600 GCACACTGCCTTCCATAATGTGG + Intergenic
1045052544 8:98340281-98340303 CCTCTCTTCCTTTCAAAATCTGG - Intergenic
1048957977 8:139552524-139552546 ACACACATCCTTCCAAAAGCTGG - Intergenic
1049821239 8:144634927-144634949 GAACACTTCCCTGCACATTCTGG + Intergenic
1050833585 9:10047734-10047756 GTTTACTTCCTTGAAAAATCAGG + Intronic
1054995244 9:71380341-71380363 GCATACTTCCTCGCAACATAGGG - Intronic
1055736645 9:79337323-79337345 GCACTCTTCTTTCCAGAATCTGG + Intergenic
1056546097 9:87615124-87615146 CCTCACGTCCTTGCAAAATGTGG + Intronic
1060008051 9:120017935-120017957 CCACACTGCCTTGCAAAAACAGG + Intergenic
1062601626 9:137320990-137321012 GCACACTTCCTTGCCACCTGAGG + Intronic
1190956338 X:55198307-55198329 GCACTCTTCCTTAAAAACTCAGG + Intronic
1191029243 X:55950156-55950178 GAACACTGCCTTCCAAAGTCTGG + Intergenic
1192373958 X:70540038-70540060 GCCCACTCCCTTGCTAAAGCAGG + Intronic
1198228246 X:134666301-134666323 GCTCACTTCCCAGCAAAAGCAGG + Intronic
1199018717 X:142849575-142849597 TCACACCTCCTTGCAAACTAAGG + Intergenic
1201572986 Y:15433819-15433841 GCACACTTCCCTGCAAGCTGAGG - Intergenic
1201743145 Y:17344600-17344622 GCACACTTCCCAGCTAAAGCAGG - Intergenic