ID: 936432444

View in Genome Browser
Species Human (GRCh38)
Location 2:112476359-112476381
Sequence ATGGGCTTACAGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936432444_936432452 22 Left 936432444 2:112476359-112476381 CCCAGCTCCATCTGTAAGCCCAT No data
Right 936432452 2:112476404-112476426 TGTCACCTTTGATATAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936432444 Original CRISPR ATGGGCTTACAGATGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr