ID: 936433947

View in Genome Browser
Species Human (GRCh38)
Location 2:112487022-112487044
Sequence GTTGTTTCAGTAGGAAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936433945_936433947 17 Left 936433945 2:112486982-112487004 CCTTATTATTGCTATTAGTATAG 0: 1
1: 0
2: 0
3: 22
4: 266
Right 936433947 2:112487022-112487044 GTTGTTTCAGTAGGAAACACTGG 0: 1
1: 0
2: 1
3: 15
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936433947 Original CRISPR GTTGTTTCAGTAGGAAACAC TGG Intronic
902036776 1:13463693-13463715 TGAGTTTCAATAGGAAACACGGG - Intergenic
903276222 1:22223606-22223628 TTGGTTTCAGTTGGAAACCCTGG + Intergenic
904112088 1:28133983-28134005 GTTCCTTCAGTAGGAAAGTCTGG - Intergenic
905608794 1:39330319-39330341 GTTGCTTGAGTAGTATACACAGG + Intronic
906365203 1:45204525-45204547 GTTGTTTTGGTTAGAAACACAGG + Intronic
907528250 1:55067110-55067132 GTTGTTTCCATAGGAAATAAGGG + Exonic
908858293 1:68453852-68453874 GTGGTTTCAGTGTGATACACCGG + Intergenic
909127426 1:71691649-71691671 CTTTTTTCATTATGAAACACTGG + Intronic
909330365 1:74402230-74402252 GTTATTTCAGTAGACAACCCAGG + Intronic
910348275 1:86266133-86266155 CTTGGTTCTGTAGAAAACACCGG + Intergenic
916874235 1:168951771-168951793 TATGGTTCAGTAGAAAACACAGG + Intergenic
916876810 1:168978396-168978418 GTTGTTTTGGTAGGAAGGACAGG - Intergenic
917859709 1:179134569-179134591 ATACTTACAGTAGGAAACACAGG + Intronic
918280516 1:182999935-182999957 GTTTTCTCAGTAAGTAACACAGG + Intergenic
920378977 1:205524871-205524893 GTGGTCTCAGTCGGAGACACAGG + Intronic
922583057 1:226712716-226712738 GGTGCTTAAGCAGGAAACACAGG - Intronic
924078431 1:240366251-240366273 GTTGTTTCTGAAGGGGACACAGG - Intronic
924202843 1:241678033-241678055 GATGTTTCAGAAGGAGAAACAGG + Intronic
1063254820 10:4315613-4315635 ATTGTTTCAGTAAAAGACACAGG - Intergenic
1063744608 10:8866122-8866144 ATTGTTACAATAGGAAACAATGG - Intergenic
1065138430 10:22696265-22696287 TTTGTTTTTGTAGGAAACACAGG + Intronic
1065300878 10:24320049-24320071 GTTGTTTCATTAGGTAAAAGTGG + Intronic
1065410257 10:25418506-25418528 GTTGTTTTAGAAGAACACACTGG - Intronic
1066570752 10:36769238-36769260 GCTTTTTCACAAGGAAACACTGG - Intergenic
1070792198 10:79196211-79196233 GTTCTTTTATTAAGAAACACAGG + Intronic
1071402398 10:85286983-85287005 CTTGTTTCAGTAGAAACTACAGG + Intergenic
1073634213 10:105180788-105180810 GTTGTTTAAGTAGGGAAGGCAGG - Intronic
1075180113 10:120203840-120203862 GTTGTTACAGTAGAAAATGCTGG + Intergenic
1075871636 10:125775487-125775509 GTTGTTCCAATAGGAGCCACAGG + Intronic
1076725677 10:132411974-132411996 TTTGTTCCAGAAGGAAACAGAGG + Intronic
1076919334 10:133443170-133443192 CTTGTTTCTGTGGGAAGCACCGG - Intergenic
1079979750 11:27137837-27137859 GTTAATTCAGTAGGAAAAAAAGG - Intergenic
1082742208 11:56923630-56923652 GGTGTTTCAGTAGCAAGCACTGG - Intergenic
1085948078 11:81296618-81296640 GGTTTTTGAGTAGGAAACATGGG + Intergenic
1086868234 11:92006185-92006207 CTTGTTTAAATAAGAAACACGGG + Intergenic
1088737278 11:112738050-112738072 GTTGTTTCAGGAGGCAAACCTGG + Intergenic
1090194303 11:124801203-124801225 GTTCTTTGAGTACGAAAAACCGG - Intergenic
1091326740 11:134696318-134696340 GATGTTTCAGGAGGAAACATGGG + Intergenic
1091407238 12:216764-216786 TTTGCTGCAGTAGGAACCACTGG + Intergenic
1092670379 12:10854822-10854844 GTTGATTCAGTAGGACACTTTGG - Intronic
1092878319 12:12867782-12867804 GTTGTCTCAGTAGAAGACAATGG + Intergenic
1095434633 12:42174011-42174033 ATTGTTTAAGCAGGAAACAAAGG - Intronic
1099257232 12:80329056-80329078 GTTGGTTCTGTGGGAATCACAGG - Exonic
1099830135 12:87832011-87832033 GTAGTTTCAGAAGGAAAAAGAGG + Intergenic
1102421009 12:112802866-112802888 GGTGTTACAGGAGGAAACCCAGG - Intronic
1108432587 13:50368979-50369001 GTTGTTTCAGTAGGAAAAGAAGG - Intronic
1110681804 13:78322520-78322542 GTGGGTTCAGGAGGAAACAATGG + Intergenic
1110898182 13:80783846-80783868 GACATTTCAGTATGAAACACAGG - Intergenic
1115959519 14:38819784-38819806 GTTGTTTTGTTAGGAAACACAGG + Intergenic
1116662086 14:47723435-47723457 GTTGTCTAAGTGGGAAACAGAGG + Intergenic
1120409286 14:84131583-84131605 GGTACCTCAGTAGGAAACACTGG - Intergenic
1122318655 14:100840351-100840373 GCTGTTTCAGATGGAAACAAAGG + Intergenic
1125073263 15:35581883-35581905 GTTGTTTCTGAATGAAACAATGG + Intergenic
1125247353 15:37656299-37656321 ATTGTTTGTGTAAGAAACACAGG - Intergenic
1126895683 15:53254685-53254707 GATGTTTCAGGAGGGAAAACTGG + Intergenic
1127581292 15:60341430-60341452 TATGTATCAGTAGGGAACACAGG - Intergenic
1135988089 16:27199105-27199127 GGTGTCTCAGTGGGAAAGACTGG - Intergenic
1137596554 16:49727775-49727797 GATGTTTCTGTAGGAACCAGAGG - Intronic
1139565390 16:67772311-67772333 GTTGTGTCACTATGAACCACCGG + Intronic
1145068161 17:19778291-19778313 GGTGTTACAGGAGGAAGCACTGG + Intronic
1146224660 17:31055096-31055118 GTCGTTTCAGTAGCAAAGAATGG + Intergenic
1154025645 18:10705062-10705084 GTTGTCTCTGAAGGAAAAACAGG - Intronic
1154191989 18:12237479-12237501 GTGGTTTCTGCAGGCAACACTGG - Intergenic
1157029322 18:43886029-43886051 GTTGTATAAGAAGGAAAAACAGG - Intergenic
1158745844 18:60198801-60198823 CTTATTTCTGTAGGAAACACAGG - Intergenic
1159379665 18:67640322-67640344 GTCTTTTCAGTGGGAAACATTGG + Intergenic
1160067354 18:75588457-75588479 GTTGTTTCTGGAGCAGACACTGG + Intergenic
1160273959 18:77412822-77412844 ATTGTGTCAGTATGCAACACTGG + Intergenic
1163648321 19:18502791-18502813 GTTGTCTCAGAAGCAAAAACAGG - Intronic
1163812463 19:19442239-19442261 GTTGTATCAGAAGGACCCACAGG + Intronic
1167190120 19:47981598-47981620 GTTGGTTCAGTAGGAAGTAACGG + Intronic
928070143 2:28206800-28206822 GTTGTAAGAGTAGTAAACACTGG - Intronic
928095636 2:28403351-28403373 GATGTTTCTGTGGGAAACTCTGG - Intronic
930599378 2:53425282-53425304 GATGGTTCAGGAGGACACACTGG - Intergenic
932663548 2:73678436-73678458 CTTGATTCCGTAGGGAACACTGG + Intergenic
936433947 2:112487022-112487044 GTTGTTTCAGTAGGAAACACTGG + Intronic
937159644 2:119747818-119747840 GTTGCTTCAATAGAATACACAGG + Intergenic
939586674 2:144014215-144014237 GATGTTTCAGTAAGGAACTCTGG + Intronic
941766441 2:169302327-169302349 GTATTTTCATTAGGAGACACAGG - Intronic
942658876 2:178243469-178243491 GTTGCTTCAGTCAGAAACCCAGG + Intronic
943059955 2:183032021-183032043 GTTATTTCAGTAGTTAACATTGG + Intronic
944621420 2:201519324-201519346 GTTGGTTCAGCAGGGTACACTGG - Intronic
944976086 2:205052962-205052984 CTTGTCTCAGTAGAACACACAGG - Intronic
945203539 2:207309001-207309023 GTTGGTTCAGAAGGACAGACAGG - Intergenic
947455173 2:230247571-230247593 GTTGTTTGAGTTGGAAAGAATGG - Intronic
1169216479 20:3797221-3797243 GTTGTTCCAGTAGGAGAACCTGG + Intronic
1179426619 21:41284522-41284544 GTGGTTTCTGTAGGAAAGAAGGG - Intergenic
950006590 3:9695513-9695535 CATGTCTCAGTAGGTAACACCGG - Intronic
951650651 3:24948151-24948173 GGTCTTTGAGTAGGAAGCACTGG + Intergenic
952563780 3:34630157-34630179 ATTGCATCAGTAGGAAAGACGGG + Intergenic
952913598 3:38212222-38212244 GTTGTTTCATTGGGAAGCAGAGG + Intronic
955727777 3:61951257-61951279 ATAGTTTCAGCAGAAAACACTGG - Intronic
956944209 3:74200206-74200228 GATGTTTCAGTAGGATGCAGTGG - Intergenic
957181545 3:76885517-76885539 ATAGTTTCAGTAGGAATCATGGG - Intronic
957314551 3:78560569-78560591 TTTGAATCAGTAGGCAACACTGG + Intergenic
957465979 3:80591905-80591927 TTTGTCTCAGTGGGAAACAAAGG - Intergenic
957613398 3:82498086-82498108 GTTGTAGCAATAGGAAACTCCGG + Intergenic
957895314 3:86413782-86413804 GTTTGTTCAGTTGGAAAGACTGG - Intergenic
960094268 3:113673364-113673386 TTTGTTTCAGAAAGAAAAACCGG - Exonic
960588593 3:119344304-119344326 CTGGTTTCAGACGGAAACACGGG - Intronic
963225406 3:142857112-142857134 GCTGGTTCAGTAGGAAGCATGGG - Intronic
964367666 3:155967092-155967114 GTTGTTCCAATAGGAAAGATGGG + Intergenic
964444872 3:156748305-156748327 GTAGTTTCAGCAGTAAGCACAGG - Intergenic
965370086 3:167851446-167851468 GTTGTGTTAGCAAGAAACACGGG + Intergenic
965904362 3:173685454-173685476 ATTGTTTAAGTAGGAATCATGGG - Intronic
966016210 3:175140793-175140815 GTTTTTGCAGAAGGAAACAGAGG + Intronic
966592856 3:181700812-181700834 GATGTTTGAGGAGGAAACACTGG - Intergenic
966885124 3:184373234-184373256 CTTGTCTAAGTAGGAAAGACAGG + Intronic
970915775 4:21332725-21332747 GTTGTTTCAGTACTAAACACAGG - Intronic
971975413 4:33679761-33679783 ATTCTTTCAGTAGTAAAAACAGG + Intergenic
974393499 4:61305468-61305490 GTAGTTGCTGTAGGAAACACTGG + Intronic
976956374 4:90905444-90905466 ATTGTTTCAGAAAGAAAAACTGG - Intronic
981067691 4:140502848-140502870 GATTTTTCAGAAGGAATCACGGG - Intergenic
981569442 4:146135780-146135802 TTTGTTTCAGGAGGAAAAATGGG - Intergenic
985420358 4:189779190-189779212 ATTGTTTCCTCAGGAAACACGGG - Intergenic
986129451 5:4913452-4913474 GTTTTTTTAGTATGAAAAACTGG - Intergenic
986241775 5:5966589-5966611 GTTTTTCCAGTAGGGAAAACTGG + Intergenic
987235836 5:15940716-15940738 GTTGTTTAAGCAGCTAACACAGG - Intergenic
987788789 5:22536909-22536931 GTTATTTCTGTAGGTCACACAGG - Intronic
988291441 5:29293584-29293606 GTTATTTCTCTAAGAAACACAGG - Intergenic
988364403 5:30277310-30277332 GTTGTTTCAGTAGCAGGCCCTGG - Intergenic
988922076 5:35952652-35952674 GTTGATTCAACAGAAAACACAGG + Exonic
989602042 5:43209415-43209437 TTTGTTTCAGGAGAAAACACTGG + Intronic
989952866 5:50321355-50321377 TTTGTTACATTAGGAAACTCAGG - Intergenic
990440790 5:55842947-55842969 GTTGTGGCAGCAGGAAAGACGGG - Intergenic
991221157 5:64219846-64219868 GTAGTTTCACTATGAAACACTGG - Intronic
992345496 5:75872282-75872304 TTTCTTTCAGTACTAAACACTGG - Intergenic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
992934271 5:81685643-81685665 GTTCTTGCGGTAGGAAGCACAGG + Intronic
993043036 5:82836946-82836968 GTTGTTTAAGTAAAAAATACTGG - Intergenic
994746722 5:103687234-103687256 GTTGTCTCAGTGGGTAACAATGG - Intergenic
997232305 5:132253885-132253907 GTTGGTTCAGCAGAACACACAGG - Intronic
997397231 5:133572213-133572235 GATTTTTCAGTAGGAAATAATGG + Intronic
998434230 5:142093803-142093825 ATATTTTCAGTAGAAAACACGGG + Intergenic
1000513566 5:162212796-162212818 GTTTTTTAAGTAGTAGACACAGG - Intergenic
1000921556 5:167144381-167144403 GTTGTCTCAGAAGGAAGCCCCGG + Intergenic
1002075311 5:176705042-176705064 GTGGCTTCTCTAGGAAACACAGG - Intergenic
1003293049 6:4797931-4797953 GTTGTTTGAGTATGATACCCAGG + Intronic
1003829934 6:9997059-9997081 TTTCTTTCACCAGGAAACACAGG - Intronic
1012274748 6:97259488-97259510 AGTGTTTCAGTATGAAGCACAGG - Intronic
1012779482 6:103539372-103539394 TTTGGTTCAGTAGGACCCACGGG + Intergenic
1019912774 7:4110792-4110814 GCTGTTACAGGAGGAAACACTGG + Intronic
1022067126 7:26870344-26870366 GTTCTATCAGAAGGAAACAAAGG - Intronic
1022837914 7:34134549-34134571 TTTGCTCAAGTAGGAAACACTGG - Intronic
1024928660 7:54645869-54645891 GTTCTTTCAGGAGGAAACCTGGG + Intergenic
1026454888 7:70562413-70562435 GTTTTTTCAGTAGGAGTAACGGG - Intronic
1027436008 7:78165062-78165084 ATTGTTTCAGTAGGCAACTATGG - Intronic
1028487191 7:91372969-91372991 ATTGTTTCAATAGGAAAAAGGGG + Intergenic
1029866702 7:103639181-103639203 GTAGTTTTACTAGAAAACACAGG + Intronic
1030681375 7:112437850-112437872 GTAGTTTCAGTAGGAAGGAGAGG + Intronic
1033503322 7:141975993-141976015 GTAGTGTCAATAGGAAACACTGG + Intronic
1035068214 7:156123104-156123126 GTGGCTTCAGCAGGACACACAGG - Intergenic
1039132814 8:34286767-34286789 GTAGTTTCAGTAGAACACATGGG - Intergenic
1040397896 8:47016851-47016873 GGTGTTTCAGTAAGAAAACCAGG + Intergenic
1040995238 8:53394396-53394418 GTTGTTTCAGTAGGATCTTCCGG - Intergenic
1041979166 8:63835997-63836019 GTTGTTCCAGCAGGGCACACAGG - Intergenic
1043428546 8:80171918-80171940 ATACTTACAGTAGGAAACACAGG + Intronic
1044277430 8:90318504-90318526 ATTGTCTCAGTAGGAGACTCGGG - Intergenic
1046161427 8:110371298-110371320 GTTGTTTCATTAAGAAAAAATGG + Intergenic
1051322906 9:15928854-15928876 GTTGTTTGTATAGGAAACAGGGG + Intronic
1055485565 9:76753422-76753444 TTTGTTGCAGTAGAAAACACAGG - Intronic
1055809025 9:80130018-80130040 GTTGTTGAAGAAGGTAACACAGG + Intergenic
1057366577 9:94427694-94427716 TTTCTTTCAGTGGGAAATACAGG - Intronic
1057656757 9:96960370-96960392 TTTCTTTCAGTGGGAAATACAGG + Intronic
1059118610 9:111621312-111621334 TTTGTTTCAGTGGGACACAGTGG + Intergenic
1060578730 9:124723570-124723592 TTTGTGTCATTAAGAAACACAGG + Intronic
1060776470 9:126378394-126378416 CTTGTTGCTGTAGGAAAGACAGG + Intronic
1186770907 X:12817156-12817178 TTTATTTCCGTAGGAAACACAGG - Intronic
1187147700 X:16652641-16652663 GTTGTTTCAAAAGGTAACACGGG + Intronic
1189155485 X:38752201-38752223 GTTGAGCCAGTAGAAAACACAGG - Intergenic
1193378998 X:80796493-80796515 TTTGTTTTCCTAGGAAACACAGG + Intronic
1194334833 X:92632539-92632561 TTTGTTTAAGTAGGCAACAGAGG - Intergenic
1194762346 X:97809765-97809787 GTTGTTTCAGCCTGAAAAACAGG + Intergenic
1199651606 X:149950394-149950416 TTTGTTATAGTTGGAAACACAGG - Intergenic