ID: 936433976

View in Genome Browser
Species Human (GRCh38)
Location 2:112487261-112487283
Sequence TACCCACTCCTCTCTGTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936433973_936433976 -8 Left 936433973 2:112487246-112487268 CCCTGGTAACTTATGTACCCACT 0: 1
1: 0
2: 1
3: 10
4: 100
Right 936433976 2:112487261-112487283 TACCCACTCCTCTCTGTGATGGG 0: 1
1: 0
2: 1
3: 7
4: 140
936433974_936433976 -9 Left 936433974 2:112487247-112487269 CCTGGTAACTTATGTACCCACTC 0: 1
1: 0
2: 2
3: 3
4: 80
Right 936433976 2:112487261-112487283 TACCCACTCCTCTCTGTGATGGG 0: 1
1: 0
2: 1
3: 7
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936433976 Original CRISPR TACCCACTCCTCTCTGTGAT GGG Intronic
907811241 1:57872547-57872569 TACCCACTGGTCACTGTGCTTGG + Intronic
908235640 1:62145225-62145247 TAGGCACTCTTCTATGTGATGGG + Intronic
911172230 1:94782203-94782225 TTCCCTCTCTTGTCTGTGATAGG + Intergenic
912164338 1:107024390-107024412 TACTCACTCCATTCTGTCATGGG + Intergenic
913382298 1:118225791-118225813 TTATCAATCCTCTCTGTGATTGG - Intergenic
914976264 1:152366103-152366125 ATCCCACTCCTTTCTGAGATGGG + Intergenic
915525282 1:156472279-156472301 TACCCACTCCTCTTACAGATGGG + Intronic
919065226 1:192685529-192685551 TACCACCTCCTCTGTGGGATCGG + Intergenic
922152882 1:223020498-223020520 TCTCCCCTCGTCTCTGTGATGGG + Intergenic
922772480 1:228194118-228194140 TTCCCATTCCTTTCTCTGATGGG + Intergenic
1062790148 10:298491-298513 CACCCTCTCCTCTCTGGCATGGG - Intronic
1063786723 10:9393461-9393483 TTCCCACACCCCTCTGTGCTTGG + Intergenic
1064270004 10:13856484-13856506 TGGCCACACCTCGCTGTGATTGG - Intronic
1067687572 10:48476364-48476386 CACCCACTCCTGTCTGTCAGAGG + Intronic
1071424475 10:85534268-85534290 TACCCACTTCTATCTCTGTTAGG + Intergenic
1075674144 10:124284115-124284137 CACCCTCTACTCACTGTGATGGG + Intergenic
1075962216 10:126578898-126578920 TAGCCACTCCCTTCTGGGATTGG - Intronic
1080278132 11:30525860-30525882 AACCCAATCCTCTGTGTTATGGG - Intronic
1088898135 11:114093254-114093276 AACCCAAGCCTCTCTGGGATAGG - Intronic
1089661728 11:119990509-119990531 CACCAACCCCTCCCTGTGATTGG + Intergenic
1091169654 11:133508641-133508663 TTCCCACTCCTCCAAGTGATTGG - Intronic
1093857902 12:24127799-24127821 CACTCACTTCTCTATGTGATTGG - Intergenic
1094528143 12:31246653-31246675 GATCCACTCCTCTCTGTTAGAGG - Intergenic
1094528413 12:31249295-31249317 GACCCACTCCTCTCTGGTAAAGG - Intergenic
1094757113 12:33484256-33484278 TATCCACTCATCTCTGCCATAGG + Intergenic
1095284934 12:40399016-40399038 TACTCCTTCCTCTCTGGGATAGG + Intronic
1096512719 12:52140529-52140551 GACCCCCTCCTCCATGTGATAGG - Intergenic
1096695388 12:53345250-53345272 TCCCTACTCCTCTCTGTGTGGGG - Intronic
1101080100 12:101173106-101173128 TACCCACTCTACTCTGTGCCTGG + Intronic
1107031401 13:35857730-35857752 TATCCACTGCCCTCTGTGAAGGG - Intronic
1110509254 13:76329422-76329444 TTACCATTTCTCTCTGTGATAGG - Intergenic
1111041584 13:82756599-82756621 TTCCCACTCCAGTCTGTGATGGG - Intergenic
1113626385 13:111850989-111851011 GACACCCTCCTCTCTGTGAAAGG + Intergenic
1118061521 14:62143367-62143389 GTCAGACTCCTCTCTGTGATTGG - Intergenic
1118699238 14:68416922-68416944 TAACTTCTCCTCTCTGTGGTTGG + Intronic
1122944064 14:104997318-104997340 TTCCCTCCCCTCTCTGTGTTTGG - Intronic
1124230326 15:27939747-27939769 TACCCACTCCTCACTGTGAGAGG - Intronic
1124856109 15:33390903-33390925 TACCCATTCCCTCCTGTGATGGG - Intronic
1126180304 15:45778838-45778860 TACACTCTCCTCACTGTAATGGG - Intergenic
1126262142 15:46705511-46705533 TACTCATTCCTCTCTGTACTAGG + Intergenic
1130459583 15:84151313-84151335 GACAAACTCCCCTCTGTGATAGG - Intergenic
1131614927 15:94006152-94006174 TTCTCAATCCTCCCTGTGATTGG - Intergenic
1132196199 15:99916392-99916414 TACCCCTCCCTCACTGTGATGGG + Intergenic
1133125539 16:3643534-3643556 CACCCACTCCGCTCCGTGGTGGG - Intronic
1134334735 16:13287953-13287975 TCCACACTCTTCTCTGTGAATGG - Intergenic
1139675987 16:68523914-68523936 TTCTCAATCCTCCCTGTGATTGG + Intergenic
1140046802 16:71445023-71445045 TACCCATGCTTCTGTGTGATAGG - Intergenic
1142285650 16:89170534-89170556 AGCCCGTTCCTCTCTGTGATGGG - Intergenic
1143416513 17:6754822-6754844 TACCCACTCCTGTCTGTCTCTGG - Intergenic
1146417314 17:32647918-32647940 TGCCCAGTCCTCAGTGTGATAGG - Intronic
1146973318 17:37090548-37090570 GACCCTCTCCTCTCTGTGCCTGG + Intronic
1148207444 17:45787966-45787988 TACACACTCCTCTCTATGGCTGG - Intronic
1152553975 17:81043932-81043954 TACCCAGTACTCTCTGTGCCAGG - Intronic
1152926290 17:83089227-83089249 TACCCACTGCTCCCTGTTCTTGG + Intronic
1158122140 18:54060103-54060125 TACCCACCCCTCTCTAAGAGAGG - Intergenic
1160159787 18:76462191-76462213 TGCCCGCTCCCCACTGTGATGGG - Intronic
1160755758 19:756385-756407 CACCCACTGGCCTCTGTGATTGG - Intronic
1161076279 19:2287332-2287354 CACCCCCTCCTGTCTTTGATAGG + Intronic
1162247793 19:9417006-9417028 TACTCATTCTTTTCTGTGATAGG - Intronic
1164507170 19:28870035-28870057 AACCCACCCTCCTCTGTGATGGG + Intergenic
1165723742 19:38098352-38098374 TGCCCACTTCTTTGTGTGATGGG - Intronic
1166922214 19:46236808-46236830 CACCCACTCCCTTCTGAGATGGG - Intergenic
925040656 2:731241-731263 GCCCCACCCCTCACTGTGATGGG + Intergenic
926834207 2:16999432-16999454 TTCCCTCTCCTCTCTGTAAGTGG + Intergenic
932839527 2:75068730-75068752 TACCCAATAGTCTCTGTGAGTGG - Intronic
936433976 2:112487261-112487283 TACCCACTCCTCTCTGTGATGGG + Intronic
941099603 2:161281771-161281793 TTCCCTGTCCTCTCCGTGATGGG + Intergenic
942310561 2:174652928-174652950 TTTCCACTCCTCTATGAGATTGG + Intronic
943897483 2:193383633-193383655 TTTCCAATCCTCCCTGTGATTGG - Intergenic
947282511 2:228471035-228471057 TACTCACTCCTTTCTCTGCTTGG + Intergenic
1168762653 20:360088-360110 TTCCCTCTCCTCTCTGAGGTGGG + Intergenic
1168918116 20:1508283-1508305 TCCCCACTCCACTCTTGGATTGG + Intergenic
1169981626 20:11391267-11391289 TGCCCAAACCTCTATGTGATGGG - Intergenic
1170772420 20:19344686-19344708 TACCAACTCCTGTCTGCTATTGG + Intronic
1171158995 20:22904719-22904741 GTCCAACTCCTCTCTGTGAGTGG - Intergenic
1173566383 20:44041307-44041329 TACCCATTCCCCTGTGTGCTGGG - Intronic
1174726846 20:52871555-52871577 TTCCCACTCCTCCCTGTGGGAGG + Intergenic
1178065768 21:28902798-28902820 TTCTCAATCCTCCCTGTGATTGG + Intergenic
1179646609 21:42779764-42779786 TCCCCACTCCTCTGTGTGTCAGG - Intergenic
1179884185 21:44306465-44306487 TACCCCCTGCCCTCTGAGATGGG + Intronic
1181013792 22:20056964-20056986 CACCCACACCCCTCTGTGAGGGG + Intronic
1181267008 22:21636300-21636322 TACCCATTCATGTTTGTGATGGG + Intronic
1181914579 22:26269374-26269396 TACCCACTGCTCTCTGGCAGGGG + Intronic
1182136081 22:27904455-27904477 TACCCACTCCTCCCAGTGCCTGG - Intronic
1183168597 22:36166824-36166846 TACCCACTTCTCTATTTAATTGG + Intergenic
954774048 3:52999773-52999795 TGCCCATTCCTCTCCCTGATGGG + Intronic
958647594 3:96892169-96892191 CACACACACCTCTCTGTGCTTGG + Intronic
959314048 3:104779577-104779599 TTCTCAATCCTCCCTGTGATTGG - Intergenic
960585742 3:119319996-119320018 GACCCACACCTCTCTGTGTATGG + Intronic
960757326 3:121030284-121030306 TATCCACTCCTATCACTGATGGG - Intronic
965498413 3:169427703-169427725 TCTCAACTCCTCTCTGTGATGGG - Intronic
966807570 3:183818977-183818999 TACCCACTCCTCTGCAAGATGGG + Intronic
969198749 4:5584873-5584895 TACTCACTGCTCTCTGGGTTTGG - Intronic
969427433 4:7133582-7133604 TACCCACTCTTCACTGGCATTGG - Intergenic
970325583 4:14920223-14920245 TTCCCACTCCTCTCTGGAATTGG - Intergenic
975031921 4:69631639-69631661 TACACACTCCTCTCCTTGCTTGG - Intronic
985229414 4:187798986-187799008 TACCCTCTCCTCTCTGCAAGGGG - Intergenic
986291135 5:6400020-6400042 TATTCTCTTCTCTCTGTGATGGG + Intergenic
988504406 5:31809399-31809421 TATCCTCTCCTGTCTGTGACTGG + Intronic
992324667 5:75648921-75648943 TACCCACTCCCCTTGATGATGGG - Intronic
994419659 5:99516238-99516260 TTCCCTCTCTTCTCTCTGATCGG + Intergenic
994487549 5:100398903-100398925 TTCCCTCTCTTCTCTTTGATCGG - Intergenic
994956622 5:106541310-106541332 TACTCACTCCTCTCTATGTCTGG + Intergenic
995158199 5:108941281-108941303 TACCCACTCCTTTTTTTGACAGG - Intronic
995245056 5:109925529-109925551 TACCCACTCCCCTCTTTTATTGG - Intergenic
997748184 5:136318217-136318239 GACACACTCCTCACTGTAATTGG + Intronic
997934163 5:138096113-138096135 TACCCATGCATATCTGTGATGGG + Intergenic
998854880 5:146385189-146385211 TACCCACTTTTCTTTGTGTTGGG - Intergenic
1001270897 5:170310922-170310944 TTCCCTTTCCTCTGTGTGATGGG + Intergenic
1001697618 5:173683807-173683829 TCCCCAATCCTCTTTGTGACAGG + Intergenic
1007630171 6:43269138-43269160 TCCCAACACCTCCCTGTGATGGG + Intronic
1007753140 6:44081980-44082002 TCCCCAGGCCTCCCTGTGATTGG - Intergenic
1008706793 6:54171094-54171116 TATCCATTCCTCTCTGGGAGGGG + Intronic
1011165649 6:84442904-84442926 GACACAGTCCTCTCTGTGTTGGG + Intergenic
1018897542 6:168030826-168030848 TACTCACTTCTCTCTTGGATGGG + Exonic
1018901896 6:168055855-168055877 GACCCTCTCCTTTCTGTGAAAGG - Exonic
1020369755 7:7418981-7419003 TTCCCTCTCCTCTCTGAGAATGG + Intronic
1020418031 7:7968801-7968823 TACCCACTCCTCACTCCGAATGG - Exonic
1022357705 7:29631357-29631379 CACCCACTCCTCCCTCTCATAGG + Intergenic
1022368024 7:29744312-29744334 CACCCACTCCTCCCTCTCATAGG + Intergenic
1022617550 7:31947209-31947231 TACCCAATCCATTCTTTGATTGG - Intronic
1023326972 7:39070927-39070949 CATCCACTCCTCTAAGTGATGGG - Intronic
1030391337 7:108931815-108931837 TTCCCTCTCCTCTCTTTGAGTGG + Intergenic
1031163109 7:118192490-118192512 TACCCACACCTCTCAGTGCTAGG - Exonic
1032519655 7:132534343-132534365 GACCCCCTCCCCTCTGTGAGAGG + Intronic
1035100352 7:156391060-156391082 TACGCACTCCTCTCTTGTATTGG - Intergenic
1039903712 8:41771003-41771025 CACCTACTCCTCTATGTGACTGG + Intronic
1041370191 8:57151158-57151180 AAGTCACTCCTCTCTGGGATGGG - Intergenic
1044412931 8:91904009-91904031 CCCCCACTCCACTCTCTGATAGG - Intergenic
1049059693 8:140266876-140266898 AACCCACTCATCTCTGTGTTAGG + Intronic
1049170770 8:141159308-141159330 GAGCCAATCTTCTCTGTGATGGG - Intronic
1050224826 9:3441779-3441801 TACCCACACCTCTAGGAGATAGG + Intronic
1051999971 9:23266473-23266495 TACCAACTCCGGTCTGTTATTGG - Intergenic
1056454939 9:86751095-86751117 AAACCACTGCTCCCTGTGATGGG - Intergenic
1058465131 9:105219674-105219696 TAGCTACTCATCTCTGGGATGGG - Intergenic
1059312577 9:113398823-113398845 TTCCCACTCCATTCTGTGAGTGG + Intronic
1061441999 9:130611584-130611606 TATTCAATCCTTTCTGTGATGGG + Intronic
1203568633 Un_KI270744v1:111677-111699 TTCCCTGTCCTCTCCGTGATGGG - Intergenic
1185925171 X:4138003-4138025 TATCCACTCATCTCTTTGATGGG - Intergenic
1186055205 X:5642807-5642829 TATCCATTCCTCCCTTTGATGGG - Intergenic
1187260635 X:17682377-17682399 AACACACTCCTCCCTGTCATGGG + Intronic
1188831257 X:34900347-34900369 TAACCCATCCACTCTGTGATTGG + Intergenic
1189214089 X:39308577-39308599 TACCCAGTCCTGTCTGTCAATGG + Intergenic
1191111314 X:56804872-56804894 TACCCATGCCTCTCAGTGACTGG + Intergenic
1195621599 X:106961645-106961667 TTTTCAATCCTCTCTGTGATTGG - Intronic
1197119734 X:122876126-122876148 TACCCCATCCCATCTGTGATAGG - Intergenic
1197657153 X:129128872-129128894 TACTCCCTCCTCACTGTGAGGGG + Intergenic
1198026106 X:132708785-132708807 TTCCCATTGCTCTCTGTGAAGGG - Intronic
1200830759 Y:7687181-7687203 TTCCCAGTATTCTCTGTGATGGG + Intergenic