ID: 936434076

View in Genome Browser
Species Human (GRCh38)
Location 2:112488058-112488080
Sequence ACTGAACCCCACCAAGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936434076_936434089 29 Left 936434076 2:112488058-112488080 CCAGAGCCTTGGTGGGGTTCAGT 0: 1
1: 0
2: 0
3: 18
4: 167
Right 936434089 2:112488110-112488132 CCTGTCACTTCAGGGAGTTTCGG 0: 1
1: 0
2: 2
3: 16
4: 178
936434076_936434082 20 Left 936434076 2:112488058-112488080 CCAGAGCCTTGGTGGGGTTCAGT 0: 1
1: 0
2: 0
3: 18
4: 167
Right 936434082 2:112488101-112488123 GTCCTTCCCCCTGTCACTTCAGG 0: 1
1: 0
2: 0
3: 14
4: 187
936434076_936434083 21 Left 936434076 2:112488058-112488080 CCAGAGCCTTGGTGGGGTTCAGT 0: 1
1: 0
2: 0
3: 18
4: 167
Right 936434083 2:112488102-112488124 TCCTTCCCCCTGTCACTTCAGGG 0: 1
1: 0
2: 2
3: 25
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936434076 Original CRISPR ACTGAACCCCACCAAGGCTC TGG (reversed) Intronic
900483594 1:2910956-2910978 ACTGCACCCCACCACCCCTCAGG - Intergenic
900736174 1:4300786-4300808 AGTGACCCTCACCAAGGCCCTGG + Intergenic
901965838 1:12864944-12864966 AGTGAACCCCATCAAAACTCTGG + Intronic
901974157 1:12930974-12930996 AGTGAACCCCATCAAAACTCCGG + Intronic
901981237 1:13035321-13035343 AGTGAACCCCATCAAAACTCTGG + Intronic
902000849 1:13193608-13193630 AGTGAACCCCATCAAAACTCTGG - Intergenic
902011020 1:13270794-13270816 AGTGAACCCCATCAAAACTCCGG - Intergenic
902020081 1:13339312-13339334 AGTGAACCCCATCAAAACTCTGG - Intergenic
903850418 1:26302486-26302508 ACTGAACCCCACACAGGGCCTGG + Intronic
904939455 1:34155215-34155237 TCTGCACCCCACCAAGTCTCAGG - Intronic
905216892 1:36415061-36415083 ACTAACCCTCACCAAGCCTCGGG - Intergenic
907506827 1:54925124-54925146 CCTGAGCCACACCAAGGCTGGGG - Intergenic
918877502 1:190067719-190067741 ACTGAACCCCACAAAAGCCTGGG - Intergenic
919926966 1:202196569-202196591 ACTGAACACCTCTAAGCCTCAGG + Intronic
920176493 1:204104996-204105018 TCTGAACCCCACCAACCCACAGG - Intronic
920312753 1:205058256-205058278 CATGAACCCCACCAAGGCACAGG + Exonic
921939785 1:220827747-220827769 ACTGAACCCCCCCTAGTCTCTGG - Intergenic
923072511 1:230578412-230578434 CCTGAAACCCACCCAAGCTCTGG + Intergenic
1063548273 10:7002830-7002852 ATGGAACCCAACAAAGGCTCAGG - Intergenic
1063985602 10:11498297-11498319 ACTGAGCCACACTAAGGCTGTGG + Intronic
1064353636 10:14599205-14599227 ACTGAGCCCCAGCAACCCTCAGG - Intronic
1064862980 10:19847578-19847600 ACTGAACCTTAACAAGCCTCCGG + Intronic
1068819048 10:61352142-61352164 CCTAAACCCCACAAAGGATCTGG + Intergenic
1069527745 10:69188367-69188389 ACTGCACCCCAGCAAGGCATAGG - Intronic
1070536492 10:77382022-77382044 ACTGAGCTACAACAAGGCTCAGG + Intronic
1072250246 10:93576243-93576265 ACTGAACTTCACCCAGGCTTGGG + Intronic
1072832999 10:98679120-98679142 ACAGAACCCCACAAAATCTCAGG + Intronic
1073920303 10:108450801-108450823 ACTGAACACCATCATGGCTAGGG - Intergenic
1074693635 10:116028877-116028899 ACAGACCCCCACCAGGCCTCTGG + Intergenic
1074976769 10:118587472-118587494 ACAGCACCCCACCAGGGCTGGGG - Intergenic
1075409221 10:122215021-122215043 TCTGAACCCAACTAAGGCTAGGG - Intronic
1075559363 10:123457180-123457202 ACAGAACCACACAAAAGCTCAGG + Intergenic
1075701765 10:124474589-124474611 ACTGAACCCCTCCAAACCACAGG + Intronic
1077460328 11:2705913-2705935 AATGAAACCCACCAGGCCTCTGG + Intronic
1078765187 11:14289793-14289815 TCTGAACCCCACCAGGGTTCAGG - Intronic
1082013329 11:47465784-47465806 GCTGAACCCCCCAAAAGCTCCGG - Intergenic
1083722883 11:64612073-64612095 ACTCAACCCGGCCTAGGCTCTGG + Intronic
1084323740 11:68387495-68387517 ACTGAAGCCCAGAGAGGCTCAGG + Intronic
1084457685 11:69277891-69277913 ACGGAACCCAACCCAGGGTCAGG - Intergenic
1084551586 11:69846453-69846475 ACTGAACCCCTCCCAGCCTCTGG - Intergenic
1085816126 11:79739105-79739127 ACTGAGCTTCACCCAGGCTCTGG + Intergenic
1088187375 11:107186612-107186634 CCTCAACCCCACCCAGGCTCAGG + Intergenic
1088756158 11:112887048-112887070 TCTCAACTTCACCAAGGCTCAGG - Intergenic
1090336983 11:125975870-125975892 ACTGAGCACTACCCAGGCTCTGG - Intronic
1099911450 12:88839014-88839036 TCTGGAAGCCACCAAGGCTCAGG + Intergenic
1102807945 12:115798664-115798686 ACTGAACCTCTACAAAGCTCTGG + Intergenic
1106412495 13:29520291-29520313 AGTGTACCCCACCAAGACACAGG + Intronic
1108212768 13:48154988-48155010 CCAGAATCCCACAAAGGCTCAGG - Intergenic
1115481160 14:33862527-33862549 ATGGAACCCCACAGAGGCTCTGG - Intergenic
1119898905 14:78243573-78243595 CCTGAACTCCATCAAGGGTCAGG - Intronic
1120902809 14:89590477-89590499 ACTGAATCCTAAGAAGGCTCAGG + Intronic
1121437643 14:93929629-93929651 AATGAGCCCCACCCAGGCTGAGG + Intergenic
1121782021 14:96628056-96628078 ACTGCACTTCACTAAGGCTCTGG - Intergenic
1122986938 14:105216808-105216830 ACTCCACCCCACCGAGTCTCCGG - Intronic
1128286608 15:66442255-66442277 CCAGAACCCCACCAAGGAACCGG - Intronic
1128749190 15:70136554-70136576 ACTGAGCCCCACCAGGGTCCAGG + Intergenic
1129165577 15:73775365-73775387 ACTGAATCCCACCAGGGCCCAGG - Intergenic
1132995495 16:2820414-2820436 GCTGACCCCCAGCAAGGCACTGG - Intronic
1134211209 16:12279233-12279255 TCTGAAACCCACCCAAGCTCAGG - Intronic
1135262367 16:20991761-20991783 TCTGAATCCCAACAAGTCTCTGG - Intronic
1137500779 16:49010383-49010405 AATGAACCCCACCAAGGGCCAGG - Intergenic
1139721480 16:68859469-68859491 ACTGAACAGAACAAAGGCTCTGG - Intronic
1141256052 16:82403455-82403477 AGAGAACCCCATCAAGGTTCAGG - Intergenic
1141436602 16:84003143-84003165 ACCGAACCCCAGTAAGACTCAGG - Intergenic
1141752656 16:85969499-85969521 ACAGAACCTCACAAGGGCTCAGG - Intergenic
1143876141 17:9992140-9992162 ACGGAACCCAGCCAAGGATCAGG + Intronic
1144174383 17:12690844-12690866 ACTGAGATCCAGCAAGGCTCTGG + Intronic
1145019456 17:19418086-19418108 ACTCAACCCCACCCTGGCTTTGG - Intergenic
1148934948 17:51157704-51157726 ACTGAACCTCTCCAAGCCTTAGG - Intronic
1157280716 18:46344856-46344878 ACAGAACCAAGCCAAGGCTCTGG - Intronic
1160554496 18:79717010-79717032 GCTGTACCCCACTAGGGCTCAGG - Intronic
1160554517 18:79717077-79717099 GCTGCAGCCCACCAGGGCTCAGG - Intronic
1160554528 18:79717111-79717133 GCTGTACCCCACCAGGGCTCAGG - Intronic
1160554575 18:79717239-79717261 GCTGTACCCCACCAGGGCTCAGG - Intronic
1160554613 18:79717361-79717383 ACTGCACCCCTGCAGGGCTCAGG - Intronic
1160554631 18:79717422-79717444 GCTGTACCCCACCAGGGCTCAGG - Intronic
1160983922 19:1828752-1828774 ACTGGCGCCCGCCAAGGCTCTGG + Intronic
1162151039 19:8645803-8645825 ACCAGACCTCACCAAGGCTCTGG - Intergenic
1162337118 19:10068646-10068668 ACTAAACCTCACCAAGGTTTTGG + Intergenic
1162361803 19:10224860-10224882 CCTGAACCCCAACAAGGTCCAGG - Exonic
1162578628 19:11514110-11514132 GCAGAGGCCCACCAAGGCTCTGG - Exonic
1166164502 19:40977846-40977868 ACTGAACCCCACTGAGGTTTTGG - Intergenic
1168414920 19:56161623-56161645 ATAGAACCCCTCCCAGGCTCAGG - Intergenic
930032698 2:47068246-47068268 ACTGAGCCCCACCCAGTGTCAGG - Intronic
932284476 2:70520726-70520748 ACTACAGCCCACCAAGGCACCGG + Intronic
933063610 2:77768247-77768269 ACTGCACCCGACCAAGCCTGGGG - Intergenic
933749145 2:85591937-85591959 CCTCAACCCCACCAAGGAACTGG - Intronic
933811106 2:86033256-86033278 ACTGAGGCCCACCAGGGCACTGG - Intronic
934915454 2:98297934-98297956 ACTGAAGCCCACCAGTGCTTGGG - Exonic
936261132 2:110960218-110960240 AATGAACCCAAGCAAGGTTCAGG + Intronic
936434076 2:112488058-112488080 ACTGAACCCCACCAAGGCTCTGG - Intronic
938607582 2:132911835-132911857 GCTGAACTCCCCCATGGCTCCGG + Intronic
939026863 2:137024379-137024401 ACTAAACCCCACCCTGCCTCAGG - Intronic
940926265 2:159366895-159366917 AGTGAGCCACACCAAGGGTCAGG + Intronic
941307784 2:163892356-163892378 ACTGTAAGCCACCAAGGCTTGGG + Intergenic
941763640 2:169272390-169272412 ACTGAGCCACCCCAATGCTCAGG + Intronic
942076939 2:172364859-172364881 ACTCAACCCCAGCAAGAGTCAGG + Intergenic
948105755 2:235412378-235412400 TCTGAATCCCATCCAGGCTCAGG + Intergenic
948262654 2:236615463-236615485 ACTGATCCACACACAGGCTCCGG - Intergenic
1169317424 20:4604284-4604306 ACTGCACCCCAGCCTGGCTCTGG - Intergenic
1171016890 20:21549987-21550009 TCTGCACACCAACAAGGCTCTGG + Intergenic
1171435358 20:25118001-25118023 ACAGAAACCCAGAAAGGCTCAGG + Intergenic
1173154903 20:40600642-40600664 TCTGAACCCCACCCAGGGTGGGG + Intergenic
1175366408 20:58459414-58459436 ACTGAACCCCACACAGTCTCAGG + Exonic
1176182703 20:63758378-63758400 ACAGAAACCAAACAAGGCTCCGG + Intronic
1177811043 21:25925321-25925343 TCTGAAACTCCCCAAGGCTCGGG + Intronic
1179152154 21:38818278-38818300 ACAGACCCCCACCAAAGCCCGGG + Intronic
1180168799 21:46046737-46046759 ACACATCCTCACCAAGGCTCAGG + Intergenic
1184640030 22:45865780-45865802 ACTGAGGCCCACCAAGGCTAAGG - Intergenic
1185267625 22:49912521-49912543 ACGGAAACCCACCATGGCACGGG - Intronic
949980364 3:9498977-9498999 ACTGAACCACCCCTAGGCTGTGG + Exonic
950404981 3:12798569-12798591 ACTGCACTCCTCCAAGCCTCCGG - Intronic
950707801 3:14793769-14793791 ACTGAAGCTCACCAAGGGTGGGG + Intergenic
952741487 3:36738587-36738609 ACTGTACCCCAACAAAGCCCGGG - Exonic
953127156 3:40102338-40102360 TCAGAGCCCCATCAAGGCTCAGG - Intronic
953251229 3:41247142-41247164 TCTGAACCCCACCAGGACTGTGG - Intronic
954792495 3:53143585-53143607 ACAGAACTCCACAAAGGCTATGG - Intergenic
955597261 3:60605195-60605217 ACTGAACCAAACCAAAGCTGTGG - Intronic
957260577 3:77896848-77896870 ACTGTACCCCGCAAAGGCACAGG - Intergenic
957672466 3:83323666-83323688 ACTCAAACCCACCAAGGCAGTGG - Intergenic
957878025 3:86174590-86174612 TGTGCACCCCACCAAGTCTCAGG + Intergenic
958923429 3:100131569-100131591 ACTGACCCCCATCCAGCCTCAGG + Intronic
959636514 3:108578575-108578597 ACTGAACCCCACCTATGATCAGG - Intronic
959666847 3:108932239-108932261 TATGAACCCCACTCAGGCTCAGG - Intronic
960854755 3:122091725-122091747 AGTAAAACCCACCAAGTCTCAGG - Intronic
961422621 3:126818321-126818343 ACAGAACCCCAGCAAGGGACTGG - Intronic
961806269 3:129491558-129491580 AATGAATCCCACCAAGTCTGTGG - Intronic
962352957 3:134669058-134669080 ACTGAATTCCAGCCAGGCTCAGG - Intronic
963439600 3:145321212-145321234 ACTGAACCCCTCCAGGCTTCTGG + Intergenic
965390435 3:168096221-168096243 ACCGAACCTCACCCAGACTCAGG - Intergenic
966223577 3:177574304-177574326 ACTGAGCTCCACCATGGCTAAGG + Intergenic
967258009 3:187612986-187613008 TCTGAACCCCACAAAAGCCCTGG + Intergenic
969304381 4:6317446-6317468 ATAGAACCCCAGAAAGGCTCTGG - Intergenic
969594407 4:8140808-8140830 CCTGAACCCCACCCTGACTCAGG - Intronic
970320879 4:14874264-14874286 CCTCAACCTCCCCAAGGCTCAGG + Intergenic
971997812 4:33989131-33989153 CATGATCCCCACAAAGGCTCTGG - Intergenic
979986788 4:127325427-127325449 ACTGCACCCCACAAAGCCACAGG + Intergenic
980327819 4:131371190-131371212 ACTGATCCCTACTAAGGTTCTGG - Intergenic
980835850 4:138191279-138191301 ACTGAACCACGGCAAGGCTATGG + Intronic
985568107 5:630398-630420 ACAGAACCCCACCAGGACTTGGG - Intronic
985799069 5:1991495-1991517 ACTGAAACCCACAAAGTTTCTGG + Intergenic
986360757 5:6975803-6975825 GCTGAACCCCACCAAGTCACAGG + Intergenic
987109591 5:14672699-14672721 GCAGAACCCCAGAAAGGCTCAGG - Intronic
998294290 5:140952145-140952167 ACTGAACCCCACAAAGCCACAGG - Intronic
1000406000 5:160889124-160889146 CCTGGACCCTACCAAGCCTCTGG - Intergenic
1003317273 6:5024185-5024207 GCTGCACCCCAGCATGGCTCTGG - Intergenic
1003357844 6:5391293-5391315 ATTGAACCTCACTAAGCCTCAGG + Intronic
1007915400 6:45556968-45556990 ACAGAACACCACACAGGCTCTGG - Intronic
1016785593 6:148007405-148007427 ACTGGACCCCACATAGGCCCAGG + Intergenic
1017581952 6:155874883-155874905 ACTGATGCCCGGCAAGGCTCTGG - Intergenic
1017878942 6:158546476-158546498 ACTGAACCCCAGGAAGGAGCTGG + Intronic
1018405858 6:163481833-163481855 ACTCAACCTCCCCAAGGCTTTGG - Intronic
1021544595 7:21799249-21799271 ACAGAAGCACACGAAGGCTCTGG - Intronic
1021843501 7:24742352-24742374 ACTTAATGGCACCAAGGCTCAGG - Intronic
1023861102 7:44218115-44218137 ACTGCAGCCCGCCAAGGCACTGG + Exonic
1023891534 7:44395580-44395602 CCTCAACCCCACCAAGCCACTGG + Intronic
1024279857 7:47710069-47710091 ACTGAAACCCACCCAGCCTGGGG - Intronic
1035320209 7:158024141-158024163 AGTGCACCCCAACAAAGCTCCGG + Intronic
1042709512 8:71700615-71700637 AGTGAACCTCACAAAGTCTCAGG - Intergenic
1043274214 8:78373026-78373048 AATGGACCCCACAAAGGCTCTGG + Intergenic
1048789660 8:138088485-138088507 GCTGAGGCCCACCCAGGCTCAGG + Intergenic
1050088043 9:1987565-1987587 ACAGAAACCAACCAAGGCACTGG + Intergenic
1051234977 9:14990289-14990311 GCAGAACCTCACAAAGGCTCAGG + Intergenic
1051915020 9:22198158-22198180 AATGAAGGCCACCAAGGCTTGGG - Intergenic
1052977203 9:34420126-34420148 ACTGAACCCCAACAAGGGGGAGG + Intronic
1053347056 9:37385597-37385619 ACTGATGCCCACCAGGGCTGTGG + Intergenic
1053485861 9:38455688-38455710 ACAGGACCCTTCCAAGGCTCTGG + Intergenic
1057045065 9:91879227-91879249 ACTGCACCACACCAAGGGCCTGG + Intronic
1057077171 9:92144022-92144044 ACTGAACACCTCTAAGCCTCAGG + Intergenic
1059246600 9:112854827-112854849 ACTGAGGCCCACAAAGGCTGAGG - Intronic
1059440132 9:114301937-114301959 ACTGGGGCCCACCAAGCCTCCGG + Intronic
1062149954 9:135012989-135013011 ACAGAGCCCCACCAAGGGGCAGG - Intergenic
1203770278 EBV:46493-46515 GCTGGACCCCACCGAGGCCCTGG - Intergenic
1186003380 X:5040122-5040144 ACTGGACCTCACCAAAGGTCTGG - Intergenic
1187126897 X:16462417-16462439 ACTGAGCCCCACCACAGCTGGGG + Intergenic
1189292988 X:39899173-39899195 ACTCCTCCCCACCAAGGCACCGG + Intergenic
1190061166 X:47212595-47212617 TCTGATCCCCACAAAGGCCCGGG - Intronic
1190101340 X:47524732-47524754 ACTGAACTTCACAAAGTCTCAGG + Intergenic
1190746863 X:53329057-53329079 AGTGAACTCCACCACGGCCCTGG - Intergenic
1195614289 X:106900616-106900638 ACTGAACCCCAATCAGACTCTGG + Exonic
1196427212 X:115582955-115582977 CCTGAACCTCCCCCAGGCTCAGG - Intronic
1198880667 X:141277644-141277666 ACTGAATCCCACAAAGTCTGTGG + Intergenic
1199677120 X:150198205-150198227 ACTGATCCCCACAACTGCTCTGG - Intergenic
1200976425 Y:9216503-9216525 ACTGAACCCCTACAAAGTTCTGG + Intergenic
1201392442 Y:13513032-13513054 ACTGACCCAAACCCAGGCTCTGG + Intergenic
1202134743 Y:21650028-21650050 ACTGAACCCCTACAAAGCTCTGG - Intergenic