ID: 936434254

View in Genome Browser
Species Human (GRCh38)
Location 2:112489980-112490002
Sequence CAGTATTCACTGATGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936434254_936434258 28 Left 936434254 2:112489980-112490002 CCCTTCTCCATCAGTGAATACTG 0: 1
1: 0
2: 3
3: 25
4: 206
Right 936434258 2:112490031-112490053 TGTCTTCTGTTTCCATGAACTGG 0: 1
1: 0
2: 2
3: 19
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936434254 Original CRISPR CAGTATTCACTGATGGAGAA GGG (reversed) Intronic
903582144 1:24379190-24379212 TTGTATTCACTGACGCAGAATGG - Intronic
904389510 1:30172702-30172724 CTGTATTCACTAATGCTGAATGG - Intergenic
905421796 1:37851717-37851739 CAGTAATCACTGATGGAGGATGG + Intronic
906580871 1:46934356-46934378 CGGTCTTCCCAGATGGAGAATGG - Exonic
906602852 1:47144538-47144560 CGGTCTTCCCAGATGGAGAATGG + Exonic
906772119 1:48494595-48494617 GAGTATACTCTGATGGAGCAAGG - Intergenic
908267680 1:62395117-62395139 CTGTCTTCCCTGATGGAGACAGG + Intergenic
909056475 1:70826684-70826706 CAGTAGTCAGGGCTGGAGAAGGG - Intergenic
910678833 1:89842486-89842508 CAGTTTTGACTGAAGCAGAAAGG - Intronic
911552709 1:99303776-99303798 CATTCTTCACTGCAGGAGAAAGG + Intronic
913167179 1:116199215-116199237 CAATATTCGCTTATGGAGAAAGG - Intergenic
914049116 1:144116969-144116991 CAGTATTCCATGGTGTAGAAGGG + Intergenic
914130068 1:144848476-144848498 CAGTATTCCATGGTGTAGAAGGG - Intergenic
914684228 1:149964283-149964305 TTGTATGCACTGATGGAGAAGGG - Exonic
914757149 1:150569624-150569646 CAGTATTCACTGACCAAGAGCGG + Intergenic
916033714 1:160902150-160902172 CACAATTCACTGAAGGAGAAAGG - Intergenic
916637434 1:166688082-166688104 TAGTATTCTCTCATGAAGAATGG + Intergenic
917078594 1:171233324-171233346 CAGTATTTACAGATGGAAAAAGG + Intergenic
918147946 1:181774468-181774490 CAGACTTCACTGATGTGGAAGGG - Intronic
918215172 1:182387082-182387104 CAGCATTCACAGATTGAGGAGGG + Intronic
919033242 1:192272700-192272722 TATTATTCTCTCATGGAGAAAGG - Intergenic
920080948 1:203372573-203372595 CAGGATTGACTGATGCAGAGTGG - Intergenic
921256283 1:213342714-213342736 CATTATTCACTTATGAATAATGG - Intergenic
921278478 1:213542503-213542525 CAGCATACACTGAGAGAGAAAGG - Intergenic
1063477195 10:6339685-6339707 CAGTGTCCACTGATGGAGAATGG + Intergenic
1064604825 10:17028066-17028088 CGATAGTCACTGATGGAGCAAGG + Intronic
1065229514 10:23582943-23582965 TGGTACCCACTGATGGAGAAAGG + Intergenic
1066997833 10:42580006-42580028 GTGTATTCACTGATGGAGGAAGG + Intronic
1070700037 10:78595264-78595286 CAGTTTTGACTGATGGAGGGTGG + Intergenic
1073703098 10:105952388-105952410 CAGTATTTACTGACTGAAAAAGG - Intergenic
1074762755 10:116679551-116679573 TAGTAGTCAATGAAGGAGAAGGG + Exonic
1075238021 10:120749391-120749413 CAGTATTTACTGACAGAAAATGG - Intergenic
1076030742 10:127155764-127155786 TAGAATTAGCTGATGGAGAAAGG - Intronic
1076126121 10:127975444-127975466 CAATATTCACTAAGGCAGAATGG - Intronic
1078644643 11:13129207-13129229 CAGTATTAACTGAGGAAAAATGG + Intergenic
1078695766 11:13629594-13629616 CAGTAGTTACTTATGGTGAAAGG - Intergenic
1079430422 11:20384494-20384516 CAGTATACACTGGAGGATAAAGG + Intergenic
1079588763 11:22157060-22157082 AAATCTTAACTGATGGAGAAGGG - Intergenic
1080358807 11:31488436-31488458 CTGAATTCTCTGATGGATAAAGG - Intronic
1081721473 11:45292334-45292356 CAGGATTCTATGATGGAGAATGG - Intergenic
1084686160 11:70696861-70696883 CTGTGCTCACTGATGGATAAAGG + Intronic
1086377342 11:86214795-86214817 CAGTGCTCACTGTTGGAGCAGGG + Intergenic
1087272279 11:96123725-96123747 CAGTGTGCACAGATGGGGAAGGG + Intronic
1088992096 11:114962542-114962564 CTGTCTTTACTGAGGGAGAAGGG - Intergenic
1091848189 12:3673874-3673896 CAGCAGTCACTGATGGAGTCAGG + Intronic
1092044252 12:5417525-5417547 CAAGATTCACTGAAGGAGAAGGG - Intergenic
1092714273 12:11372262-11372284 CATTATTAACTGAAGGAAAATGG + Intronic
1094110607 12:26858146-26858168 CAGTATTCTCTGATAAGGAAGGG + Intergenic
1095579404 12:43779686-43779708 CATGATTCACTTATGTAGAAAGG + Intronic
1100222645 12:92522488-92522510 CAGCATTCACTGTTGAATAAGGG - Intergenic
1101647279 12:106643103-106643125 CTGTATTCAGTGATGGACAATGG - Intronic
1101660896 12:106764795-106764817 CAGTCTGCACTGATGGACCAGGG + Intronic
1102332499 12:112046272-112046294 CATTTTTCCCTGCTGGAGAAAGG + Intronic
1102744336 12:115237133-115237155 CAGAATCCATTGATGGAGAACGG + Intergenic
1106094233 13:26628769-26628791 CAGTGTCCACTGGTGCAGAATGG + Intronic
1107254187 13:38403777-38403799 CAATATTCAGTCAAGGAGAAAGG + Intergenic
1107285579 13:38787064-38787086 CACAATTCACTGATGTAGACAGG + Intronic
1107749409 13:43548441-43548463 CAGAATTAAGAGATGGAGAAAGG - Intronic
1110698835 13:78523433-78523455 GAATATTCACTGATGGACCAAGG - Intergenic
1110708173 13:78619478-78619500 CAGAAGTCACTGATGGAGTTAGG + Intronic
1113012413 13:105784875-105784897 CAGCTTCCACTCATGGAGAAAGG - Intergenic
1113373998 13:109746781-109746803 CAGAAATCAATCATGGAGAAAGG + Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1116845163 14:49858592-49858614 GACTATTCACAGATAGAGAAGGG - Intergenic
1117981797 14:61348976-61348998 AAGTGTTCCCTGCTGGAGAAGGG + Intronic
1118226018 14:63900028-63900050 CAGTATCCACTGCTGTAGAATGG - Intronic
1121091606 14:91186845-91186867 CAGTTTTCCCACATGGAGAATGG - Intronic
1123192657 14:106586080-106586102 CAGGTGTCACTAATGGAGAAAGG - Intergenic
1123446807 15:20336965-20336987 CAGTATTCTATGGTGTAGAAGGG - Intergenic
1123929595 15:25157907-25157929 TAGTATTCACTGAAGTTGAATGG + Intergenic
1126463936 15:48943491-48943513 AAGTATCCACTGATGGATAAAGG - Intronic
1127923976 15:63520269-63520291 CAGTTCTTACTGTTGGAGAAAGG - Intronic
1130078511 15:80710617-80710639 CAGTATTTGCTGATGCAGAGTGG + Intronic
1131373475 15:91903982-91904004 CAGGACACAGTGATGGAGAAAGG + Intronic
1131436958 15:92430720-92430742 CACTTGTCATTGATGGAGAATGG - Intronic
1132216347 15:100064444-100064466 CACTATTCACTGATGCACCAGGG - Intronic
1133649019 16:7791943-7791965 AAGAATTCTCTGATAGAGAAGGG - Intergenic
1140433280 16:74923248-74923270 CAGTATTAAATGATAGAGCATGG + Intronic
1140770403 16:78198477-78198499 CAATAAATACTGATGGAGAATGG + Intronic
1140843784 16:78867062-78867084 AAGTATTCACAATTGGAGAAGGG + Intronic
1141318885 16:82988088-82988110 CAGTCTTCAATGATTGAGGAAGG - Intronic
1143872764 17:9969509-9969531 CAGTGTTCCCTGATGGGGAGAGG - Intronic
1147915885 17:43885586-43885608 AAGTTCTCACTGAAGGAGAAGGG - Intronic
1150113536 17:62523638-62523660 CAGCATTAACTGATGAAGATGGG - Intronic
1150925481 17:69527717-69527739 GAGTACTCACTGCTGGGGAAGGG + Intronic
1153778283 18:8472837-8472859 AAGAATTCCCTGATGAAGAAAGG - Intergenic
1156365953 18:36427410-36427432 CAGCATTCAGGGATGGAGAGGGG - Intronic
1159727878 18:71985253-71985275 CATTATTAACTGATGAAAAATGG - Intergenic
1160625105 18:80198735-80198757 AAGTATTCACATATGGAGAATGG + Intronic
1165680782 19:37773030-37773052 AAGTATTAAGTGATGGAAAATGG - Intronic
1166552334 19:43674515-43674537 CAGTTTTCTCAGCTGGAGAAGGG + Intergenic
1167618559 19:50549114-50549136 CAGTTTTCCCTGCTGCAGAATGG - Intronic
1202688567 1_KI270712v1_random:69863-69885 CAGTATTCCATGGTGTAGAAGGG + Intergenic
927336882 2:21935383-21935405 GAGTATTCACTCAAGGATAAGGG - Intergenic
928094293 2:28394269-28394291 GAGTTATGACTGATGGAGAACGG - Intronic
928361634 2:30666744-30666766 CAGTATTTACAGATAGAAAAAGG - Intergenic
928444789 2:31323601-31323623 CTGTATTCAATCATGGAGATTGG + Intergenic
929278675 2:40053975-40053997 CATTATCCATTGATGGACAATGG - Intergenic
931128065 2:59299484-59299506 CAGAAAACACTGATAGAGAATGG + Intergenic
932062601 2:68522736-68522758 CAGTTCAAACTGATGGAGAAAGG + Intronic
933957863 2:87386224-87386246 CAGTATTCCATGGTGTAGAAGGG - Intergenic
934513677 2:94969862-94969884 CATTATTCCTTGATTGAGAAAGG - Intergenic
936434254 2:112489980-112490002 CAGTATTCACTGATGGAGAAGGG - Intronic
937350707 2:121159083-121159105 AAGTATTTAATGATGCAGAAAGG - Intergenic
938767928 2:134474309-134474331 CACTACCCACTCATGGAGAAGGG + Intronic
938928635 2:136066747-136066769 CAAGATTCACAGATGGAGGATGG + Intergenic
941435590 2:165467250-165467272 AAGCATTCATTGATGGACAAGGG - Intergenic
941751768 2:169141986-169142008 CAGTTTTAGCTGATGGGGAAAGG - Intronic
943420615 2:187663442-187663464 AAGTATTTAGTGAAGGAGAAGGG + Intergenic
945440717 2:209875767-209875789 GTGTTTTGACTGATGGAGAATGG - Intronic
1170788951 20:19491893-19491915 AACTAATCACTGATGGAGGAAGG - Intronic
1171135148 20:22688853-22688875 CAGCATGCACAGATGGGGAAAGG - Intergenic
1173018208 20:39245748-39245770 CAGTTTTCACAGAGGGAGGAGGG + Intergenic
1173400297 20:42720299-42720321 CAGTATTCACATATGTAAAATGG - Intronic
1175190289 20:57207362-57207384 CTGTAGTCACTGATGGAGCTAGG - Intronic
1175627087 20:60498106-60498128 CAGGATTCACTGTTGGAAAATGG + Intergenic
1176055305 20:63142292-63142314 CCGTGTTCTCTGATGGTGAATGG - Intergenic
1181380098 22:22495302-22495324 CAATATTCATTAATGGAAAAAGG - Intronic
1182706831 22:32287869-32287891 CAATATTTAATGATGGAGTAGGG - Intergenic
1183417216 22:37689286-37689308 CCCAGTTCACTGATGGAGAAAGG - Intronic
1184395102 22:44230572-44230594 CAATATTCAATGATGGAGTGGGG - Intergenic
1184395148 22:44230969-44230991 CAATATTCAATGATGGAGTGGGG - Intergenic
950865753 3:16187904-16187926 TTGTTTTCACTGAGGGAGAATGG - Intronic
954821154 3:53328898-53328920 CTGTAATCAGTGAAGGAGAAAGG - Intronic
955485015 3:59426427-59426449 CTGTCTTCAAAGATGGAGAAAGG - Intergenic
956651041 3:71505073-71505095 TAGTATTCACTGGTGGTTAAGGG - Intronic
956871803 3:73425621-73425643 CAGTACTCACTGGGTGAGAAGGG - Intronic
958747947 3:98160502-98160524 CAGTATTCAGTGAAGGAAAAAGG - Intergenic
958754354 3:98233168-98233190 TAGTATTCACTGAAGGAAAAAGG - Intergenic
958758745 3:98281588-98281610 TAGTATTCAGTGAAGGAAAAAGG - Intergenic
958790732 3:98648150-98648172 CATTATTAACTGAAGAAGAATGG + Intergenic
960319921 3:116222033-116222055 CAATATCAAGTGATGGAGAATGG - Intronic
960774874 3:121238250-121238272 CTGTTTTCACTCATGGTGAAAGG + Intronic
961550292 3:127667029-127667051 CTTTATTCACTGATTGAGTATGG - Intronic
961595745 3:128014784-128014806 CAGTTTTCACAGAGAGAGAAAGG - Intergenic
962206515 3:133439449-133439471 CACAAATCAGTGATGGAGAAAGG + Intronic
962334258 3:134511831-134511853 TAGTCTTCAATGTTGGAGAAGGG - Intronic
962940906 3:140124102-140124124 CAGTATGAACTGCTGGAGAAAGG + Intronic
964563765 3:158026527-158026549 GAATATTCATTGATGAAGAAAGG - Intergenic
969551522 4:7871287-7871309 CACCATTCCCTGATGGACAAGGG + Intronic
970155686 4:13139756-13139778 CTCTATTCACTGATGGAGCTGGG - Intergenic
970412736 4:15825285-15825307 CTGTTTCCACTCATGGAGAAGGG + Intronic
971471625 4:27032535-27032557 GAATATTCACTGATGGAAACAGG - Intergenic
971699461 4:29951419-29951441 CAGTATTCACAGATGGCTAGTGG - Intergenic
973131917 4:46658417-46658439 CAGTATGCAATGATGAAGCATGG + Intergenic
973201595 4:47509363-47509385 CATTATTGACTGAGGGAGAAAGG + Intronic
974666332 4:64967471-64967493 CAGGATTTACTGCTGGAGGAAGG + Intergenic
976652310 4:87449130-87449152 TACTATTCACAGATGGAAAAGGG + Exonic
976841893 4:89441555-89441577 CATTATTAACTGAAGAAGAATGG + Intergenic
979562819 4:122119570-122119592 CAGTATTTAATGACAGAGAATGG - Intergenic
982325156 4:154122388-154122410 CAATATTCATTGATGTAGACTGG - Intergenic
984865127 4:184274638-184274660 CAGTATGCACAGATGGTGAAAGG - Intergenic
985809714 5:2074050-2074072 GAGCTTTCACTCATGGAGAAGGG - Intergenic
986185735 5:5435504-5435526 AAGTATTTAGTGATGGAAAAAGG + Intronic
987624605 5:20381794-20381816 CAATATTAACTAAAGGAGAATGG + Intronic
987907921 5:24103099-24103121 CATTTTCCACTGTTGGAGAATGG - Intronic
988316772 5:29641374-29641396 CACTATTAACTGAAGGAAAATGG + Intergenic
989786776 5:45342007-45342029 CATTATTCACTGAAGAAAAATGG - Intronic
990715577 5:58632806-58632828 CTGTATTCAGTCATGGAGAGAGG - Intronic
994166376 5:96613556-96613578 CAGTAGTCAGTGATGGGGACGGG + Intronic
994174596 5:96697657-96697679 CAGCATTCACTGATGGCCACTGG + Intronic
994835419 5:104845904-104845926 CTGGATTCCCTGATGCAGAAAGG + Intergenic
995677674 5:114681469-114681491 CAGAATTCCCTGATGGAGCCTGG + Intergenic
995678160 5:114686439-114686461 CAGAATTCCCTGATGGAGCCTGG - Intergenic
995891887 5:116963217-116963239 CAGCAGTCACAGCTGGAGAAGGG - Intergenic
997557712 5:134815376-134815398 CAGTAGTCACTGTTGGGCAAAGG + Intronic
997704343 5:135932635-135932657 CAGTATTCTCACATGAAGAATGG + Intronic
998072094 5:139205900-139205922 CAGCTTTCACTCATGGAGGAAGG - Intronic
998278013 5:140776882-140776904 CATTATTAACTGAAGGAAAATGG + Intergenic
999129782 5:149273497-149273519 CAGTATTCTCTGTTGGGGAGGGG - Intronic
999761129 5:154702017-154702039 CAGGATTGAGTGATGGAGACAGG + Intergenic
1000046517 5:157526255-157526277 CAGTAATAACAGATGGAGAATGG + Intronic
1000306987 5:160003659-160003681 CAGTAATCACATGTGGAGAATGG - Intergenic
1001330223 5:170756747-170756769 AAGTTGTCACTGATGGAGAAAGG - Intergenic
1002467616 5:179415516-179415538 CAGTTTTCACTGAATGAGGAAGG + Intergenic
1007269010 6:40621391-40621413 CAGGATTGTCTGATTGAGAAAGG - Intergenic
1010062142 6:71635487-71635509 CAGTTTTCACTCAAGGACAAAGG + Intergenic
1010947080 6:81987460-81987482 CAGGATTCAATGATGTATAAGGG + Intergenic
1012280844 6:97326990-97327012 AAGTATTTACTGATTAAGAAGGG - Intergenic
1012745531 6:103082483-103082505 CAGTATTTATAGATGGAAAAGGG - Intergenic
1012942805 6:105433857-105433879 CAGGATTCACTCATGGATCAAGG - Intergenic
1014512571 6:122342212-122342234 CTGGCTTCACAGATGGAGAATGG + Intergenic
1018419564 6:163630353-163630375 CAGTGGGCACTGAAGGAGAAAGG + Intergenic
1018503694 6:164441546-164441568 CATTATCCTCTGATGGAGAGAGG + Intergenic
1020390638 7:7654299-7654321 CTGTATTCAGTGATGGAAATAGG + Intronic
1023957406 7:44897896-44897918 AAGTATTAACAGTTGGAGAATGG + Intergenic
1024713222 7:52041867-52041889 CAGTAATCACTGATAGATAAGGG - Intergenic
1028345215 7:89771746-89771768 TAGTAATCACTGATGGTGACTGG + Intergenic
1029375746 7:100176105-100176127 GAGTCTTCACAGATGGAGTAAGG + Intronic
1030695258 7:112578090-112578112 CTGTATCCACTGATGGTGATAGG - Intergenic
1031405149 7:121376364-121376386 GAGGAATCACTGATGAAGAAGGG + Intronic
1032043235 7:128579401-128579423 CAGCATTAACTGATGAAGATGGG - Intergenic
1032120997 7:129156418-129156440 CAGTCTGCACTGAAGGAGTAAGG + Intronic
1032333891 7:131006577-131006599 AAATATTTACTGATCGAGAAAGG + Intergenic
1033086533 7:138347345-138347367 TAGTTTTCTCTGAGGGAGAAGGG - Intergenic
1033524575 7:142197536-142197558 CTGTACTCACTCATGGAGAAGGG - Intronic
1034904217 7:154929708-154929730 AGGTCTTCACTGCTGGAGAAGGG - Intronic
1037210268 8:16377606-16377628 CAGAATTCAGTCATGGACAAGGG + Intronic
1040939156 8:52815251-52815273 CAGTATTCTTTGATGGAGGAGGG - Intergenic
1042031737 8:64483691-64483713 CAGGAATTAGTGATGGAGAAGGG - Intergenic
1044332371 8:90936253-90936275 AAGCATTCACTAATGGAAAAGGG - Intronic
1044918084 8:97137415-97137437 CAGAAGTCACTGAGGGTGAATGG - Intronic
1046897246 8:119486217-119486239 CAGATTTCCCTGTTGGAGAAAGG - Intergenic
1047349806 8:124062875-124062897 CAGTATAGACTGATGTAGACTGG - Intronic
1047875682 8:129134981-129135003 GAGTATTCATTGAGGGTGAAGGG + Intergenic
1048480447 8:134785922-134785944 CAGTATTCTATGTTAGAGAATGG - Intergenic
1051471821 9:17452277-17452299 CAGGTCTCCCTGATGGAGAAGGG + Intronic
1052639067 9:31141244-31141266 CAGTATTTAGTAATGGAAAAAGG - Intergenic
1054799381 9:69332004-69332026 CAGAATTCACAGACGGGGAAAGG - Intronic
1054949694 9:70836157-70836179 CACTTGTCACTGAAGGAGAATGG - Intronic
1055403664 9:75951084-75951106 TAGTATTAACTGATGGAAACAGG + Intronic
1055796708 9:79982394-79982416 CAATATTCAAAGATGGGGAAAGG - Intergenic
1059215791 9:112560919-112560941 AAGAATTCACAGATGAAGAAGGG - Intronic
1059217203 9:112575148-112575170 CTGTGTTAACTGAGGGAGAAAGG - Exonic
1062219743 9:135408833-135408855 CAGTTTCCTCAGATGGAGAATGG - Intergenic
1203444274 Un_GL000219v1:40606-40628 TAGTATTCACTGAAAGAAAAGGG + Intergenic
1185533045 X:837048-837070 TAGTATTCCATGATGCAGAAGGG - Intergenic
1186795179 X:13040406-13040428 CAATATTCAATTATGTAGAAAGG - Intronic
1187173786 X:16876543-16876565 CAGTAGTCATTGATGGAGGAAGG - Intergenic
1187570855 X:20499916-20499938 CACTATGCTCTGAAGGAGAAGGG + Intergenic
1187611189 X:20945169-20945191 CAGTTTTCTCTGATGTAAAATGG - Intergenic
1188175960 X:26989619-26989641 CATTATTAACTGGTGGATAAAGG - Intergenic
1188655627 X:32691757-32691779 CAGTGTCCACTGATGGATGAGGG + Intronic
1189241151 X:39525809-39525831 CCATATGCACTGATGGGGAAAGG - Intergenic
1189951062 X:46231266-46231288 CATTATTCAATGATGGAGGTGGG + Intergenic
1190034960 X:47013615-47013637 CATTATTAACTGAAGGAAAATGG + Intronic
1191724885 X:64268895-64268917 CTGAATACCCTGATGGAGAATGG - Exonic
1192248672 X:69393077-69393099 CAGTTTTCAGTGATGGACAAAGG + Intergenic
1193047189 X:77065917-77065939 CAGAATGCTCTGGTGGAGAAAGG - Intergenic
1193149754 X:78112873-78112895 CATTTTTCACTGCTGAAGAAAGG - Intronic
1193652928 X:84160745-84160767 TATTATTCACTGAATGAGAAGGG - Intronic
1195958769 X:110363426-110363448 AAGTATTTACTGATAGATAAGGG + Intronic
1198417489 X:136435268-136435290 CACAATTCACTGAGGGAGATAGG + Intergenic
1200023688 X:153235486-153235508 CAGTATTCAATGATGTAGAAAGG - Intergenic
1201266033 Y:12207615-12207637 CAGTGTCCACTGATGGATGATGG - Intergenic