ID: 936434708

View in Genome Browser
Species Human (GRCh38)
Location 2:112494237-112494259
Sequence GGCTGAATTCCATTCTGTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936434708_936434709 -4 Left 936434708 2:112494237-112494259 CCAGCACAGAATGGAATTCAGCC 0: 1
1: 0
2: 0
3: 9
4: 157
Right 936434709 2:112494256-112494278 AGCCACCAATCAGTAACTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936434708 Original CRISPR GGCTGAATTCCATTCTGTGC TGG (reversed) Exonic
900848384 1:5121790-5121812 GGCTGAGTTCCACCCTGTGTTGG - Intergenic
902961677 1:19968052-19968074 GGATGAATTCCATTCCCTGGAGG - Intergenic
905520503 1:38595842-38595864 GACTGAATTCAAATCTCTGCAGG + Intergenic
905972309 1:42151359-42151381 GGCTGAACTCAATGCTGGGCTGG - Intergenic
907937181 1:59052613-59052635 CACAGAATTCCATTCTGGGCAGG - Intergenic
914201777 1:145491456-145491478 GGCTGAATTCCAGACTATGCTGG + Intergenic
914480901 1:148064580-148064602 GGCTGAATTCCAGACTATGCTGG + Intergenic
916208895 1:162342479-162342501 TGCTGTAGTCCATTCTCTGCTGG - Intronic
918036669 1:180880127-180880149 TGGTGAATTCCGTGCTGTGCGGG + Exonic
918049027 1:180958433-180958455 GACTCAATTCCTTTCTGTTCTGG + Intergenic
918317609 1:183334905-183334927 GGCTGACTTCCTGTCTGTTCTGG + Intronic
920020975 1:202956546-202956568 GGCTTAGTGCCATTATGTGCAGG + Intronic
922425205 1:225485779-225485801 GGCTGAATCCCATTGTGTTATGG - Intergenic
923202501 1:231725792-231725814 GGCTGAAGGCCCTTCTGGGCTGG + Intronic
923292965 1:232564532-232564554 GCCTGATTTTCATTCTGTCCAGG - Intergenic
1063298551 10:4830983-4831005 TGCTGAATTATATTGTGTGCAGG + Intronic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1066316225 10:34249538-34249560 GTCAGAATTCCAGTCCGTGCTGG + Intronic
1069064490 10:63928458-63928480 GGGTGACTTCCCCTCTGTGCTGG + Intergenic
1069453382 10:68535002-68535024 GGTTGAAATACATTCTGTGCTGG - Intergenic
1075856665 10:125635793-125635815 GGCTGGGTTCCAGTCTGGGCTGG - Intronic
1076545140 10:131240141-131240163 CGCTGGCTTCCATTCTGTGCAGG + Intronic
1077107648 11:848976-848998 GGCTGACTTCCAGCCTGGGCTGG + Intronic
1077284071 11:1758180-1758202 GGCTGGAGTCCAGTCTGTACTGG - Intronic
1089891901 11:121889857-121889879 CACTGAATTCCACTCTGAGCAGG + Intergenic
1091155617 11:133368825-133368847 GGCTGAATACCATGCTGGGTAGG - Intronic
1092084705 12:5746501-5746523 ACCTGATTTCCATTCTGGGCAGG - Intronic
1093090166 12:14911567-14911589 GGCAGCATGCCATGCTGTGCAGG - Intergenic
1094467295 12:30766789-30766811 GGCAGAATTCAATTTTTTGCAGG - Intergenic
1095502435 12:42855263-42855285 TGCTTCATTCCATTCTGTGTTGG - Intergenic
1097700216 12:62812269-62812291 GTCTGATTTGCATCCTGTGCTGG - Intronic
1098241820 12:68475591-68475613 GGCTGCATTCAAATCTGTCCTGG - Intergenic
1098539612 12:71639776-71639798 AGATGAAGTCCATTATGTGCTGG + Intronic
1100765241 12:97856877-97856899 GGTTGAATTGCACTCTGTCCTGG - Intergenic
1102425847 12:112843855-112843877 GGCTGAATTCCATTATGACTGGG + Intronic
1104364606 12:128165654-128165676 GGCTGAATTCAGTTCTTTGCAGG + Intergenic
1106141287 13:27014463-27014485 TGCTGTATTCCATCCTGGGCGGG - Intergenic
1107580882 13:41783964-41783986 AGCTGTATTGCATTCTGTGTTGG - Intronic
1108274052 13:48790140-48790162 GGCTGCATTCAAATCTGTCCTGG + Intergenic
1110612238 13:77501817-77501839 GGATTAACTCCATTCTGAGCTGG + Intergenic
1111188380 13:84774647-84774669 GGCTGAATTCAAATCTTAGCAGG + Intergenic
1113367960 13:109695464-109695486 GGTTGTATTCCATTGTGTGGAGG - Intergenic
1118062855 14:62159984-62160006 GGCTGAATCCTATGCTGTACTGG + Intergenic
1120364545 14:83548722-83548744 GGCTGAAATCAATGCTGTGTTGG + Intergenic
1125569077 15:40701105-40701127 AGCTGGATTCCATACTGTGGAGG + Exonic
1126549025 15:49907057-49907079 GGCTGACTTCCACACTCTGCTGG - Intronic
1129311186 15:74710500-74710522 GGCTAAAGGCCACTCTGTGCTGG + Intergenic
1130259219 15:82342814-82342836 GGCTGCATGCCATTCTTTTCGGG - Exonic
1130269458 15:82436351-82436373 GGCTGCATGCCATTCTTTTCGGG + Exonic
1130282049 15:82526369-82526391 GGCTGCATGCCATTCTTTTCGGG + Intergenic
1130473416 15:84242532-84242554 GGCTGCATGCCATTCTTTTCGGG + Exonic
1130480830 15:84356596-84356618 GGCTGCATGCCATTCTTTTCGGG + Intergenic
1130490882 15:84431163-84431185 GGCTGCATGCCATTCTTTTCGGG - Intergenic
1130502466 15:84509962-84509984 GGCTGCATGCCATTCTTTTCGGG - Intergenic
1130595695 15:85247110-85247132 GGCTGCATGCCATTCTTTTCGGG + Intergenic
1131321247 15:91393578-91393600 GGCTGAATACTATTCTGTTGTGG + Intergenic
1131893556 15:97000826-97000848 GGCTGAATTTCATTGTCTGTAGG + Intergenic
1134191684 16:12126248-12126270 TGCTAAATGCTATTCTGTGCTGG + Intronic
1134295703 16:12943715-12943737 AGCTGACCTCCATTCTGTTCTGG + Intronic
1135615286 16:23906125-23906147 TGCTGAATTGCTTTCTGTACAGG + Intronic
1139849315 16:69941025-69941047 GGCTGCACTCCATTCTGAACAGG - Exonic
1140773888 16:78231909-78231931 CACTGAATTCCATATTGTGCAGG - Intronic
1145051315 17:19663852-19663874 GTGTGAATGCCATTTTGTGCAGG - Intronic
1145102658 17:20089742-20089764 GCCTTAATGCCAATCTGTGCTGG + Intronic
1147534740 17:41312377-41312399 GGCGGACTTCCATTCACTGCTGG - Intergenic
1148318378 17:46725239-46725261 TACTGAATTCTGTTCTGTGCTGG + Intronic
1152329647 17:79664954-79664976 GGCTGAATTCTATTATTTTCTGG + Intergenic
1153875484 18:9366643-9366665 GACAGAAATCCATTCTATGCAGG - Intronic
1155704393 18:28790613-28790635 GGCTCATTTCCTTTCTGTGGAGG + Intergenic
1156890562 18:42185465-42185487 AGCTGAATGCCATTCTGAGAAGG - Intergenic
1160432548 18:78821748-78821770 GGCTGAATGACAGGCTGTGCTGG + Intergenic
1160565255 18:79783055-79783077 GGCGGAGTTCAGTTCTGTGCTGG - Intergenic
1161819773 19:6522638-6522660 GTCTGAACTCCTATCTGTGCTGG - Intergenic
1165272977 19:34726145-34726167 GCCTGATGTCCATTCTGGGCAGG + Intergenic
1166074419 19:40405418-40405440 GGCTCAATTCCAGTCCGTGCTGG - Intronic
927323643 2:21777931-21777953 TGCTGAATTTCAAGCTGTGCAGG - Intergenic
927617878 2:24618476-24618498 GGCTGAATTCCATTGGCTGAAGG - Intronic
930093526 2:47549010-47549032 GTCTGAATAACAATCTGTGCAGG + Intronic
930814721 2:55583198-55583220 TGCTGAATTCCATACTGGGCTGG - Intronic
933371073 2:81416288-81416310 TGCTGACTTCCAGCCTGTGCTGG + Intergenic
936434708 2:112494237-112494259 GGCTGAATTCCATTCTGTGCTGG - Exonic
937952564 2:127399905-127399927 GGCTGAATTCCACTGTATTCTGG - Intergenic
940513935 2:154655840-154655862 TGCTAAATTCCATTCATTGCTGG - Intergenic
940697074 2:156993132-156993154 GGATGTCTTCCATTCTGAGCAGG + Intergenic
942549320 2:177098126-177098148 GGCTGAATTCAAAGCTGTCCTGG + Intergenic
945447788 2:209958731-209958753 GGCTGACTTCCTTTCAGTTCTGG - Intronic
947332871 2:229048421-229048443 ACTTGAATTCCCTTCTGTGCTGG + Intronic
948036648 2:234863437-234863459 GGCTGAAGCCCATTCTGAGGGGG + Intergenic
1169301570 20:4446032-4446054 GGCAGCATGCCAGTCTGTGCAGG - Intergenic
1170411767 20:16100039-16100061 TGCTGAATTTCATCCTCTGCTGG - Intergenic
1172165764 20:32898166-32898188 GGATGAATTCAAGTCTGTCCAGG - Intronic
1172819026 20:37715612-37715634 GGCCGAATTCCCTTGTGTACAGG + Intronic
1173830098 20:46077800-46077822 ACCTGTATTCCATTCTGTGCTGG + Intronic
1174006122 20:47412139-47412161 GGCTGTCTTGCATCCTGTGCTGG + Intergenic
1175715081 20:61249985-61250007 GGCTGAAGACCATTCTTTGGAGG + Intergenic
1179381051 21:40899504-40899526 GGCAGCATTCCATTCTCTGGAGG - Intergenic
1184528954 22:45042383-45042405 GCCTGACCTCCATTCTGTGCGGG + Intergenic
1184615160 22:45633024-45633046 GCCTGCATTCCCTTCTGTGGGGG + Intergenic
950884374 3:16349916-16349938 GGCTGAATTCCTTCCTCTTCCGG + Intronic
952205921 3:31181518-31181540 GGCTGTATTCCGATATGTGCAGG - Intergenic
953403526 3:42648009-42648031 GGCGGAATTCAGTTCTTTGCTGG + Exonic
953420830 3:42751913-42751935 GTATGAATTCTCTTCTGTGCTGG - Intronic
954394460 3:50286142-50286164 GACTGAATTCCATTTGCTGCAGG + Intronic
959064171 3:101640427-101640449 GCCTGATGTCCATTCTGGGCGGG + Intergenic
960040346 3:113144002-113144024 GGGTGAATTGCATTCAGTGAAGG + Intergenic
960487907 3:118275792-118275814 GGCTGAATTCCCTTTTGGGGTGG - Intergenic
968986505 4:3878387-3878409 GGCTGCATTCAAATCTGTCCTGG + Intergenic
969236387 4:5868056-5868078 GGCTGAGTTCCATTCTGGAATGG - Intronic
969263907 4:6051819-6051841 GTTTAAAGTCCATTCTGTGCAGG - Intronic
970174266 4:13322758-13322780 TGCTGGAATCCATTCTGTTCTGG - Intergenic
971252935 4:24988419-24988441 GCCTGTTTTACATTCTGTGCTGG - Intergenic
972366817 4:38383600-38383622 GGCTGAAGTCCTTTCTGCACAGG - Intergenic
973002566 4:44969382-44969404 TACTGGATTCCATTCTGTGATGG + Intergenic
974290681 4:59925868-59925890 GGCTGAGTTCCCTCATGTGCTGG - Intergenic
974529983 4:63096408-63096430 GGCAGAATTCCCTCCTGTTCTGG + Intergenic
975126863 4:70792756-70792778 GGTTCAAGTCCAATCTGTGCAGG - Intronic
978086855 4:104665510-104665532 AGCTGAATTCCATTCTTCCCTGG + Intergenic
979531772 4:121775996-121776018 GGCTGAATAATATTCTGTGATGG + Intergenic
979963038 4:127044276-127044298 GGCTCAATTTCCTTCAGTGCTGG - Intergenic
983767206 4:171499305-171499327 GGCTGGTTTCCAGTCTGTGAGGG - Intergenic
986167407 5:5287143-5287165 GGAACAATTCCATTCTCTGCAGG - Intronic
986997665 5:13625766-13625788 TGTTAAATTCCATTCTGTGTGGG - Intergenic
989020818 5:37005010-37005032 GGCTGCATTCAAATCTGTCCTGG - Intronic
990439091 5:55825889-55825911 AACTGAAATCCATTCTGTGATGG + Intergenic
998711291 5:144828290-144828312 GGCTGAATTCAAAGCTGTTCTGG + Intergenic
999536006 5:152518367-152518389 AGCTGCATTCAATTCTTTGCAGG + Intergenic
999971617 5:156869412-156869434 GTATGAATTCAATTCAGTGCAGG + Intergenic
1001087942 5:168715059-168715081 GGGTGAATTCTCTTCTGAGCAGG + Intronic
1003220545 6:4157249-4157271 GGCAGAATTCCTTTCTGCTCAGG + Intergenic
1003462581 6:6344640-6344662 GGTTAAATTCCTTTCTGTGGAGG - Intergenic
1007095199 6:39208648-39208670 GGATGGATGGCATTCTGTGCAGG + Intronic
1014113050 6:117642096-117642118 TGCTGAATTCCAATCTTTACTGG - Intergenic
1016225234 6:141726843-141726865 GGCTGTTTACAATTCTGTGCTGG + Intergenic
1018326036 6:162670176-162670198 TGCTGAATTCCATTCTTTCAGGG + Intronic
1018543557 6:164911211-164911233 AACTGAATTCCATTTTCTGCAGG + Intergenic
1019009445 6:168831185-168831207 GGCTGCATTCAATGCTGTCCTGG - Intergenic
1020559698 7:9715619-9715641 AGCAGAATTCAATTCTTTGCTGG + Intergenic
1020971510 7:14947948-14947970 GTCTGAAATCCATTCTCTGAAGG - Intronic
1021585292 7:22201298-22201320 GGCTGCATCCCATTCAGAGCAGG + Intronic
1022481602 7:30747075-30747097 ATCTGAATTCCATCCTTTGCTGG - Intronic
1026806242 7:73430928-73430950 GGCTGAGTACTATCCTGTGCTGG + Intergenic
1031143826 7:117975612-117975634 GGCAGAATTCCATCATTTGCTGG + Intergenic
1031434464 7:121715169-121715191 ATTTGAATTCCCTTCTGTGCTGG - Intergenic
1031840537 7:126732937-126732959 GGCTGCATTCCAAGCTGTCCTGG - Intronic
1032233723 7:130101348-130101370 GGTTGCATTTTATTCTGTGCTGG - Intronic
1034643078 7:152620496-152620518 GGCTGAGTTCTATTTTGTGTTGG + Intergenic
1038123640 8:24646344-24646366 GGCTGAATACAATTCTGTATTGG - Intergenic
1039691532 8:39870030-39870052 GCCTGAATTCTACTCTGGGCAGG + Intergenic
1039722664 8:40181279-40181301 TGCAGAATTCCATTTTGTTCAGG - Intergenic
1041409050 8:57533645-57533667 GGCTGAATGCAAAACTGTGCTGG + Intergenic
1043192073 8:77237941-77237963 AGCTGAATTACACTCTGTGAAGG + Intergenic
1046964783 8:120152008-120152030 GGCTGAATTTCTTTCTGTAGGGG - Intronic
1049701063 8:144012897-144012919 GGCTGCATTCCCTCCTGTCCAGG + Intronic
1051114853 9:13683056-13683078 GGCTGCCTTCCATTCTTGGCTGG + Intergenic
1055624630 9:78163197-78163219 GGCTGAATTCCTCTCTATTCTGG + Intergenic
1058393036 9:104519293-104519315 GGCAGAATTCCTTTCTTTTCTGG + Intergenic
1058538434 9:105987777-105987799 AGCTTAATTCCTTCCTGTGCAGG - Intergenic
1058608201 9:106746085-106746107 GGCTGATTTCCAACCTGGGCAGG + Intergenic
1061573273 9:131490713-131490735 GGCTGGATTCCAGACTGTGGGGG - Intronic
1186261830 X:7788484-7788506 GACCAAGTTCCATTCTGTGCAGG + Intergenic
1187234879 X:17457826-17457848 GCCTGGAATACATTCTGTGCTGG - Intronic
1188841093 X:35018409-35018431 GGCTGAATTCCTTTCTGATTGGG - Intergenic
1193680931 X:84518381-84518403 GGGTGAAATGCATTCTGTGAGGG + Intergenic
1195651398 X:107288826-107288848 GGCTGAATTCCAATTTATTCCGG + Intergenic
1196151375 X:112378322-112378344 GGCTCAATGTCATTCTGAGCAGG - Intergenic
1196170309 X:112580045-112580067 GGCTGATTTCCATGTTTTGCTGG - Intergenic
1199095218 X:143730367-143730389 GGCAGCATTCCATTTTTTGCAGG - Intergenic