ID: 936436820

View in Genome Browser
Species Human (GRCh38)
Location 2:112515215-112515237
Sequence CCCTGTGTATGGGCTGCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936436815_936436820 2 Left 936436815 2:112515190-112515212 CCATGGCAGAGTAATCCAGAGTA 0: 1
1: 0
2: 1
3: 7
4: 110
Right 936436820 2:112515215-112515237 CCCTGTGTATGGGCTGCATATGG 0: 1
1: 0
2: 0
3: 13
4: 104
936436814_936436820 3 Left 936436814 2:112515189-112515211 CCCATGGCAGAGTAATCCAGAGT 0: 1
1: 0
2: 0
3: 8
4: 79
Right 936436820 2:112515215-112515237 CCCTGTGTATGGGCTGCATATGG 0: 1
1: 0
2: 0
3: 13
4: 104
936436813_936436820 18 Left 936436813 2:112515174-112515196 CCAAAATCTAGATTACCCATGGC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 936436820 2:112515215-112515237 CCCTGTGTATGGGCTGCATATGG 0: 1
1: 0
2: 0
3: 13
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936436820 Original CRISPR CCCTGTGTATGGGCTGCATA TGG Intronic
900886566 1:5419627-5419649 CCCAGTCAATGGGCTGCACAGGG - Intergenic
902159162 1:14515626-14515648 CCCTGTTTAGGGGCTGCCTTAGG + Intergenic
904422382 1:30402574-30402596 CCCTGTGTAAGGGCAGGATAAGG + Intergenic
906824928 1:48969175-48969197 CCATATGTTTGGTCTGCATAAGG + Intronic
909371172 1:74885064-74885086 CCCTGTGTGTGTGCAGCCTAGGG + Intergenic
911180905 1:94859473-94859495 CCGTGTGTGTTGGCTGCATGAGG + Intronic
916427215 1:164692221-164692243 GCCTGGGTATGAGCTGCCTATGG - Intronic
917596225 1:176531955-176531977 TCCTGTGTAAGGGCTGCCTGGGG + Intronic
919990042 1:202703279-202703301 CCATGTGTATGGGCGGCGGAGGG - Intronic
922035764 1:221846361-221846383 GCATGTGTATTGGCTGCATGGGG - Intergenic
923151924 1:231241242-231241264 TCCTGTGTAGCGGCTGCAGAGGG + Exonic
1067236753 10:44457654-44457676 CCCTAAGTGTTGGCTGCATACGG + Intergenic
1070032972 10:72694657-72694679 TCCTGTGTATGTGCAGCAGATGG + Intronic
1074815553 10:117139093-117139115 CCCTTTGAATGGGCTGCCTCAGG - Intergenic
1075986848 10:126795551-126795573 CCTTAAGTGTGGGCTGCATATGG + Intergenic
1076139437 10:128068011-128068033 CCCTGTGCTGGGGCTGCGTAGGG - Intronic
1076930754 10:133530163-133530185 CCCTGGGCATGGGCTGCACCTGG + Intronic
1078511415 11:11987083-11987105 CCCTGTGTCTGTGCTGGACATGG - Intronic
1089283535 11:117391248-117391270 ACCTGTGTCTGGGCTGCCTGGGG + Intronic
1091306830 11:134541653-134541675 CCCTGAGCAGGGGCTGCATTGGG + Intergenic
1094123804 12:27001436-27001458 CCCTGTGTTTGGTTTCCATATGG - Intronic
1095523397 12:43095385-43095407 CCCTGTGTATGTCTTCCATATGG + Intergenic
1098069130 12:66652844-66652866 GCCTGTGTATGCCTTGCATATGG + Intronic
1100465242 12:94838712-94838734 CCCTGAGTATGGGCTGGACTTGG + Intergenic
1101711505 12:107271238-107271260 GCTTGTGTATGGGCTCCTTATGG - Intergenic
1101724409 12:107377165-107377187 CCCTGGACATGGGCTGCCTAGGG - Intronic
1103905428 12:124325181-124325203 CCCTGAGTAAGGTCTGCACAGGG + Exonic
1105332704 13:19432812-19432834 CCCTGTTTATAGGCTGCTTATGG + Intronic
1105878983 13:24586965-24586987 CCCTGTTTATAGGCTGCTTATGG - Intergenic
1105920853 13:24962085-24962107 CCCTGTTTATAGGCTGCTTATGG + Intergenic
1112954602 13:105042302-105042324 CCATGTGTCGAGGCTGCATAGGG + Intergenic
1117223782 14:53634245-53634267 CCCTTTGTAGGTGCTCCATAAGG + Intergenic
1121661790 14:95640598-95640620 CCAGGTGTATGGGCTGCGTGGGG - Intergenic
1123706754 15:22956240-22956262 CCCTGTGTCTGAGCAGCATGAGG + Intronic
1124416608 15:29477727-29477749 CCCTGTGTATGGGGTGGGCATGG - Intronic
1127646218 15:60961970-60961992 CCCAGTGCATGAGCTGCAGATGG + Intronic
1128851544 15:70962809-70962831 CCCTGAGTGTGGGCTGTACATGG + Intronic
1129250957 15:74308760-74308782 CCCTGGGGTTGGGCTGCAGAGGG + Intronic
1132744370 16:1430608-1430630 CCCGGTGTGTGGGCTGCAGGTGG - Intergenic
1134312024 16:13083709-13083731 CCTTGTCTATGGGCTGCTTCAGG + Intronic
1137468241 16:48730700-48730722 CACTGTGCAAGAGCTGCATAAGG - Intergenic
1148153433 17:45409834-45409856 CCCTGCTTATGAGCTGCATCTGG - Intronic
1148643737 17:49207085-49207107 CCCTGTGTCTGGGCTGGCTCTGG - Intronic
1150047078 17:61924374-61924396 CACTGTGTATGGATTCCATACGG + Intronic
1150325297 17:64252006-64252028 CCCTGGCTGTGGGCTGTATATGG + Intronic
1152550997 17:81030176-81030198 CCTTCTGTGTGGGCTGCACATGG - Intergenic
1152569263 17:81114429-81114451 GCCTGGGTAGGGGCTGCCTAGGG - Intronic
1153563543 18:6396384-6396406 CCGGGTGTCTGGGCTGCAGAAGG - Intronic
1155003645 18:21708862-21708884 CCCTGTGTACCTGCTGCATCTGG - Intronic
1157288207 18:46391861-46391883 CTGTGTATATGGGTTGCATATGG - Intronic
1158155905 18:54425297-54425319 CCCTGTGTTTGAGAAGCATATGG + Intergenic
1161302098 19:3547724-3547746 CCCTGGGTGTGGGCTGCACCAGG + Intronic
1165333442 19:35154109-35154131 CCCTGGGTCTGGGGTGCAGACGG - Exonic
1167333919 19:48873215-48873237 CCATGTGTCTGGGCTGGAAAAGG - Exonic
1167710763 19:51109079-51109101 CCCTGTGTCTAGGGTGCAGACGG - Intergenic
925067621 2:940734-940756 GCCTTTCTATGGGCTGAATAGGG - Intergenic
925412096 2:3645677-3645699 CCCCATGTATGGGCTGCACCCGG - Intergenic
925630561 2:5888659-5888681 CCATATGTATGGGCTTCCTAGGG + Intergenic
925731498 2:6922263-6922285 CCCCGTGCATGTGCTGGATATGG + Intronic
926368501 2:12155981-12156003 CCCAGACTATGGGCTGCACAAGG + Intergenic
927611484 2:24545562-24545584 CCTTGAGTATGGGCTGCACTTGG + Intronic
929745068 2:44648595-44648617 CCCTGTGTATGGTCTTTAAAAGG - Intronic
931967150 2:67546585-67546607 CCATGTTTGTAGGCTGCATAGGG + Intergenic
932397317 2:71456856-71456878 CCCTGGGTGTGGGCAGCATATGG - Intronic
933713153 2:85342462-85342484 CCCTGTGTATTTGGTGGATAAGG + Exonic
936436820 2:112515215-112515237 CCCTGTGTATGGGCTGCATATGG + Intronic
938247931 2:129793269-129793291 CCCTGTGTCTGGGTAGCACAAGG - Intergenic
939659518 2:144870840-144870862 CCATGTGTATTGACTGCTTAGGG - Intergenic
941229923 2:162899147-162899169 CACAGCATATGGGCTGCATATGG + Intergenic
942478489 2:176355822-176355844 CATTGTCTGTGGGCTGCATATGG + Intergenic
947797469 2:232904079-232904101 CCCTGTGGTTAGGCTGCATCAGG + Intronic
1173884936 20:46449204-46449226 CCTTGAGTATGGGCTGCACTTGG - Intergenic
1175251866 20:57614850-57614872 GCCTGTGTCTGGGCTGCAGAGGG - Intronic
1176740320 21:10595730-10595752 CCCTGTTTATAGGCTGCTTATGG - Intronic
1183061957 22:35341637-35341659 CCCTGTCTCTGGGCTGCAGCAGG - Intronic
1183686632 22:39364717-39364739 CCCTCTGTGGTGGCTGCATAGGG + Intronic
957785658 3:84878697-84878719 CACTGAGTATGGGCTGCGGATGG + Intergenic
961675032 3:128559583-128559605 CCCTCAGTGTGGGCTGCACATGG + Intergenic
963106744 3:141653934-141653956 CCCTGTTTATGGGCTCCAGCAGG - Intergenic
965663801 3:171069965-171069987 CCCTCTTTCTGGGCTGGATAGGG + Intronic
971310549 4:25522346-25522368 CCTGGTGGATGGGCTGCCTATGG + Intergenic
975641233 4:76502188-76502210 CACGGTGTAGGGGCTGCATCCGG - Intronic
976377651 4:84363451-84363473 GTGTGTGTGTGGGCTGCATATGG - Intergenic
980124967 4:128765518-128765540 CCTTGAGTGTGGGCTGCACAAGG + Intergenic
989475785 5:41870807-41870829 GCGTGTGTGTGGGCTGCATAGGG + Intergenic
989691595 5:44151744-44151766 ACCTGTGACTGGCCTGCATACGG + Intergenic
992190365 5:74285722-74285744 CCCTGTGTATGGGAAGCATTAGG - Intergenic
1000044021 5:157507021-157507043 CCGTGTGTGTGCGCTGCAGAAGG - Intronic
1000754710 5:165143987-165144009 CCCTGTGTTTGCTCTGCATGTGG - Intergenic
1001813453 5:174648146-174648168 CACTTAGTATGGGCTGCATGTGG - Intergenic
1002866793 6:1129123-1129145 CCCTGTGTTTGGACTGCATTTGG - Intergenic
1007039225 6:38706014-38706036 CCTTGAGTATGGGCTGGATTTGG + Intergenic
1018619242 6:165714603-165714625 CCCTGTGGATGGGCTGCGAATGG - Intronic
1019003848 6:168779652-168779674 CCCTGAGAACGGGCTGCATCTGG + Intergenic
1023310346 7:38879996-38880018 CAGTGTATATGCGCTGCATATGG - Intronic
1024803834 7:53112236-53112258 CTCTGTGTATCGCCTGCATAGGG - Intergenic
1028844908 7:95469015-95469037 ACCAGTGTATGGGCAGCATGGGG + Intergenic
1029403249 7:100358221-100358243 CCCTGTGGAGGGGCTGCCTGAGG - Exonic
1033038157 7:137894472-137894494 CTCTTTGTGAGGGCTGCATATGG - Intronic
1033416100 7:141162388-141162410 CCCTGGGTGTGGGCAGCATCCGG - Intronic
1033601326 7:142890972-142890994 GCCTGTGTGTGTGCTGCATGTGG - Intergenic
1035909523 8:3550188-3550210 GCCTGCTGATGGGCTGCATATGG - Intronic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038632372 8:29258289-29258311 CCTTGTGAATGGGAAGCATAAGG - Intronic
1041261008 8:56020501-56020523 GCCTGTGGCTGGGCTGCAAAAGG - Intergenic
1043152148 8:76731097-76731119 CCATGTGTATGGGCCCCAGATGG - Intronic
1048023288 8:130560355-130560377 CCCTCTCTTTGGGCTGCAGAAGG - Intergenic
1058532976 9:105925226-105925248 TCCTGAGTATGGGCTGGATTAGG + Intergenic
1062639985 9:137514186-137514208 CCCTGTGGCTGGGCTGCAGGCGG + Intronic
1062640047 9:137514382-137514404 CCCTGTGGCTGGGCTGCAGGCGG + Intronic
1062640138 9:137514665-137514687 CCCTGTGGCTGGGCTGCAGGCGG + Intronic
1062640196 9:137514861-137514883 CCCTGTGGCTGGGCTGCAGGCGG + Intronic
1185887182 X:3793197-3793219 CCCTTTGTATGGGGTGCACCTGG - Intergenic
1190562049 X:51695756-51695778 CCCACTGTAAGGGCTGCAGAAGG + Intergenic
1194338991 X:92686229-92686251 CCCTGTCTCTGAGCTGCATCTGG - Intergenic
1198470685 X:136943635-136943657 CCTTATATATGGGCTGCACAAGG - Intergenic
1200647384 Y:5803012-5803034 CCCTGTCTCTGAGCTGCATCTGG - Intergenic
1202598601 Y:26569604-26569626 CCCTGTTTATAGGCTGCTTATGG - Intergenic