ID: 936444698

View in Genome Browser
Species Human (GRCh38)
Location 2:112586411-112586433
Sequence CTGAACAACCAGAAGGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 2, 1: 1, 2: 0, 3: 30, 4: 274}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936444698_936444702 -9 Left 936444698 2:112586411-112586433 CCTTCATCCTTCTGGTTGTTCAG 0: 2
1: 1
2: 0
3: 30
4: 274
Right 936444702 2:112586425-112586447 GTTGTTCAGGGTAAAGACTTTGG 0: 1
1: 1
2: 4
3: 20
4: 257
936444698_936444704 25 Left 936444698 2:112586411-112586433 CCTTCATCCTTCTGGTTGTTCAG 0: 2
1: 1
2: 0
3: 30
4: 274
Right 936444704 2:112586459-112586481 GCCCCACCCCATCACCACACAGG 0: 1
1: 0
2: 5
3: 45
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936444698 Original CRISPR CTGAACAACCAGAAGGATGA AGG (reversed) Intronic
900300128 1:1973018-1973040 CTGAACACCCAGAAGGAGCTCGG - Exonic
903372923 1:22848441-22848463 CTGAGCTACCAGGAGGATGCTGG + Intronic
903760960 1:25698437-25698459 CTGAACAACCACCCGCATGAAGG - Intronic
904913135 1:33950202-33950224 CTAAACAACTAGTAGGATCATGG + Intronic
905369481 1:37475436-37475458 CTGAACAACCAACAGGGTTAGGG - Intronic
907684224 1:56594303-56594325 CTGAATAACTAGAAGGATGGAGG + Intronic
909413696 1:75381437-75381459 CTGAACATCCAGAATTATGGAGG + Intronic
911157325 1:94649876-94649898 TTGAACATGCAGAAGCATGATGG + Intergenic
911241223 1:95469796-95469818 CTGATCAAGCAGAAGAATTAGGG - Intergenic
912637591 1:111312381-111312403 CTGAAAAATAAGTAGGATGAGGG + Exonic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
915401948 1:155628665-155628687 CTGAACATCCAGAATTATGGAGG - Intergenic
915719503 1:157974098-157974120 CTGCACAACTGGAAGGATGAAGG - Intergenic
917690201 1:177460882-177460904 CTGAACAACAAGAAAGAACAGGG - Intergenic
918830635 1:189392824-189392846 GTGAACTACCAGAAGGTGGAGGG + Intergenic
920552062 1:206870369-206870391 CTGAAAAACCTGATAGATGAAGG - Intergenic
920612861 1:207458631-207458653 CTGAAGGACAAGAAGGAAGAAGG - Intronic
920629412 1:207637099-207637121 CTGAACATCCAGAATTATGGAGG - Intronic
920689303 1:208133802-208133824 CTGAATTACCAGAAGAATCAGGG - Intronic
921370554 1:214418501-214418523 ATGAACAACCACAGGGATGAAGG + Intronic
922035969 1:221848474-221848496 CTGAATTACAAGAAGGAAGACGG + Intergenic
922353177 1:224751936-224751958 CTGATGAACCAGAAGAAAGATGG + Intergenic
923365547 1:233257300-233257322 CCGAAGAACAGGAAGGATGATGG + Intronic
923663597 1:235979661-235979683 CCTGACAACCAGAAGGATAAGGG + Intronic
924429561 1:243985301-243985323 TTGAACCACTAGATGGATGATGG + Intergenic
924819443 1:247474410-247474432 CTGAATTCCCAGAATGATGAAGG - Intergenic
1064005687 10:11697117-11697139 CTGAACAACCAGAAGGATGAAGG - Intergenic
1064557660 10:16563530-16563552 CTGCAAAACTAGAAGGAGGAGGG + Intergenic
1068150261 10:53122336-53122358 CAGATCAACCAGAAAAATGAAGG + Intergenic
1068517222 10:58039437-58039459 CTGAACAAGCAGGAAGATAAGGG - Intergenic
1069880327 10:71588773-71588795 GGGAACACCCAGAGGGATGAGGG - Intronic
1073213337 10:101822214-101822236 CTGAGCAACTAGATGGATGTTGG + Intergenic
1073320078 10:102610533-102610555 GAGAACATCCAGAAGGGTGAGGG + Intronic
1075090227 10:119440169-119440191 CTGCCCACCCAGAAGGAAGAGGG + Intronic
1077921208 11:6643046-6643068 CTGAACTACCAGCTGGATAAAGG + Intronic
1078730274 11:13967253-13967275 CTCACCATCCAGAAGGCTGAGGG - Intronic
1078846483 11:15123448-15123470 CTGAGTAACCAGATAGATGATGG + Intronic
1078987349 11:16608440-16608462 ATGAACAATAAGAAGGATGAAGG + Intronic
1079181036 11:18193745-18193767 CTGCAGAATCACAAGGATGAGGG - Intronic
1080154932 11:29098625-29098647 CTGAGCAACCTGAAGGAAGCTGG - Intergenic
1081601819 11:44500599-44500621 CTGAAGAACCAGGGGGATGTTGG - Intergenic
1081652339 11:44832758-44832780 CTGAACAAGGAGAAGGCTGCAGG - Intronic
1083393175 11:62370479-62370501 CTGAACATCCAGAATTATGGAGG - Intronic
1083691748 11:64413498-64413520 CTGAGCAACCAGAGGAAGGATGG + Intergenic
1084187894 11:67484710-67484732 CTGAACAACGGGAAGGTTGTTGG - Intronic
1087724513 11:101702507-101702529 CTGAACATCCAGAATTATGGAGG + Intronic
1087947251 11:104177680-104177702 CTAAACAACTGGAAGGATGGAGG + Intergenic
1088716812 11:112555865-112555887 CTGAGCAGCCAGAAGGGTGAGGG - Intergenic
1088723641 11:112616091-112616113 CTGAAAGACCAGGATGATGAAGG - Intergenic
1089371029 11:117957736-117957758 CTGAATAACCTGAAGTCTGATGG + Intergenic
1089471359 11:118723011-118723033 CTGAACATCCAGAATTATGGAGG - Intergenic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1095898862 12:47306914-47306936 TGGAACAACCAGCAGGATGTGGG + Intergenic
1097017263 12:55996435-55996457 CTTAACACCCCGAAGTATGAAGG - Exonic
1097075042 12:56386681-56386703 CTGAAGAACCAGAAGGCTAGAGG - Intergenic
1097330664 12:58329458-58329480 CTGAACATCCAGAATTATGGAGG - Intergenic
1098052340 12:66467699-66467721 CTTAAGGAACAGAAGGATGATGG - Intronic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098957722 12:76704826-76704848 CTGAGCAAACAGAAAGATGAAGG - Intergenic
1100122825 12:91388613-91388635 CTGTACAAACACAAGGAGGAAGG + Intergenic
1100292896 12:93234614-93234636 CTCAACAAAGAGAAGGATGGGGG + Intergenic
1101490830 12:105208048-105208070 CTGAACACCCAGGAGGGTCAGGG + Intronic
1104072301 12:125356436-125356458 CTGAACACCCAGGAGGAAGGTGG - Intronic
1104294100 12:127496047-127496069 CTGGAGAACCATCAGGATGATGG - Intergenic
1106273391 13:28176973-28176995 CTGAAAAACCAGGAAGAAGAAGG + Intronic
1109207015 13:59493691-59493713 TTGAATAACCACAAGGATGAAGG - Intergenic
1109567616 13:64138168-64138190 GTTAAAAAGCAGAAGGATGAAGG + Intergenic
1110485621 13:76038217-76038239 CTCAACCTCCAGACGGATGAGGG + Intergenic
1110614000 13:77521165-77521187 CTGAAAAACAAGATGGATGCTGG - Intergenic
1111948784 13:94693178-94693200 CTGAGCAACTGAAAGGATGAAGG + Intergenic
1112148473 13:96729376-96729398 CTGAACTAAAAGCAGGATGATGG + Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1112938176 13:104826799-104826821 CTGAACAACCTGATGGATGCTGG - Intergenic
1117287918 14:54305558-54305580 ATGATCAAACAGAAGGAAGAAGG + Intergenic
1118501007 14:66362672-66362694 CTGAACCACCAGAAGCTAGAGGG - Intergenic
1118501732 14:66368515-66368537 CTCAAGAACCACAAAGATGATGG - Intergenic
1119777178 14:77256607-77256629 ATGAACAACCAGCCGGAAGAGGG + Exonic
1122403922 14:101486671-101486693 CTCAAAAACCAAAAGGATCATGG - Intergenic
1123759591 15:23422205-23422227 CTGAACGAACAGATGAATGAGGG + Intergenic
1127743089 15:61933213-61933235 CTGCAGAACCAGCAGAATGATGG + Intronic
1127908404 15:63394963-63394985 CTGGGCAACTAGGAGGATGATGG - Intergenic
1128177671 15:65570525-65570547 CTGAAGAAACAGGAGGTTGAAGG + Intronic
1128323032 15:66705817-66705839 GTGAACTACCAGAAGGCTGTGGG + Intronic
1128458504 15:67847795-67847817 CACAACAACAAGAAGGAGGAAGG + Intergenic
1131997850 15:98148922-98148944 TTGGACAACCTGAAGGATTATGG + Intergenic
1132372749 15:101309559-101309581 CTGAACAGGCAGGAGGCTGATGG - Intronic
1133962485 16:10506584-10506606 GTAAACAAGCAGAAGGAAGAAGG - Intergenic
1136930511 16:34414048-34414070 CTGAACATCCAGAATTATGGAGG - Intergenic
1136974063 16:34997760-34997782 CTGAACATCCAGAATTATGGAGG + Intergenic
1137392205 16:48091245-48091267 CTGCAGAACCCGAAGGAGGAAGG - Intronic
1137408747 16:48210101-48210123 CTCAACCACTGGAAGGATGATGG + Intronic
1137758264 16:50919655-50919677 CTGAACACCCACATGGAAGAGGG - Intergenic
1138113581 16:54342906-54342928 CTGAACAAACAGAAGCCTGTGGG + Intergenic
1139495315 16:67312680-67312702 CTGAGCAACCAGATGAATGGTGG - Intronic
1139923384 16:70473101-70473123 CTGGACCACCAGGAGGATGGGGG + Exonic
1139987032 16:70907186-70907208 CTGGACACCCAGAGGAATGAGGG - Intronic
1141093747 16:81148272-81148294 CTGAACAATCAGGAGGTTGATGG + Intergenic
1141165136 16:81655296-81655318 CAGACCAACCAGAAGGTGGAAGG + Intronic
1142368778 16:89666123-89666145 CTGGAAAACCAGAGGCATGAGGG + Intronic
1143127521 17:4653064-4653086 CTAAACAACCAGAAGGAACCAGG + Intergenic
1146486731 17:33249176-33249198 TTGAACAACTGGAAGGATGAAGG + Intronic
1148006770 17:44438569-44438591 AAGACCAAGCAGAAGGATGAAGG + Intronic
1148720319 17:49747855-49747877 CTGAACAACCAGCAAGACCAGGG - Intronic
1149623669 17:58064609-58064631 CTGCACACCCTGAAGGATGGAGG + Intergenic
1149885594 17:60336867-60336889 CAGAACAACCAGCAGGATACTGG - Intronic
1150525148 17:65915218-65915240 CTGAGCAACCAGGTGGATGGTGG - Intronic
1151198805 17:72452673-72452695 CTGAGCAACCACAGGGAAGAAGG + Intergenic
1153438427 18:5090717-5090739 TGGAACAACCAGCAGGATGTGGG + Intergenic
1156592662 18:38509227-38509249 CTGACCAAGCAGGAGGATGGGGG + Intergenic
1156686414 18:39652859-39652881 CTGACCAAAAAAAAGGATGATGG - Intergenic
1157331309 18:46705674-46705696 CTGAACAACCGCCAGGAGGAGGG - Intronic
1158173891 18:54631863-54631885 CTAAGCAAACAGAAGGATTATGG - Intergenic
1158582223 18:58693686-58693708 CTGAGTAACCAGATGGATGGTGG + Intronic
1159254028 18:65922077-65922099 GTGAACTACCAGAAGGAGGAGGG - Intergenic
1159895543 18:73992238-73992260 CTGAAAAAGCATAGGGATGAAGG + Intergenic
1160099587 18:75907630-75907652 CTGAACAACCACAAGGGGTAAGG + Intergenic
1160675018 19:385627-385649 CTGAACATCCAGAATTATGGAGG + Intergenic
1161042409 19:2117113-2117135 CTGAACAGCCAGGAGGGTGTGGG - Intronic
1161120861 19:2525464-2525486 CTGAAAGTCAAGAAGGATGAGGG + Intronic
1162127691 19:8508146-8508168 CTGTATATCCAGGAGGATGAGGG + Intergenic
1163194154 19:15702824-15702846 CTGATTAACCAGATGGATGCAGG - Intergenic
1164370501 19:27639616-27639638 CTGAACATCCAGAATTATGGAGG - Intergenic
1164511779 19:28903521-28903543 TTGAACAACCAGGAAGGTGAAGG + Intergenic
1164729877 19:30495489-30495511 CTGAACAAGCAGAGGCATGCTGG + Intronic
1165397465 19:35573467-35573489 CTGAACATCCAGAATGGTGGAGG - Intergenic
1165606395 19:37108628-37108650 CTGAACATCCAGAATTATGGAGG - Intronic
1165678237 19:37747008-37747030 CTCAAAAAACAGAAGGATCAGGG + Intronic
1165846740 19:38822772-38822794 CGGACCAACCAGCAGGATGTGGG + Intronic
1166238926 19:41476337-41476359 TTCAAAATCCAGAAGGATGATGG - Intergenic
1166241184 19:41495316-41495338 TTCAAAATCCAGAAGGATGATGG - Intergenic
1166545439 19:43632143-43632165 CTGAGCAACCAGGTGGATGGTGG - Intronic
1167764704 19:51473842-51473864 CTGAACAATCAGGATGAAGATGG - Intergenic
925898713 2:8493534-8493556 CTGAACAAACAGGCTGATGAAGG + Intergenic
925913110 2:8586211-8586233 CTGAGGAAACAGAAGCATGACGG + Intergenic
927882223 2:26696872-26696894 CTGAACAAGTAGAAGGAGTAGGG - Intronic
928071196 2:28219177-28219199 CTGAACAACCTGAAAGAGTAAGG - Intronic
930196123 2:48512205-48512227 CTGGGCAAGCAGAAGGATTATGG - Intronic
933269873 2:80221745-80221767 CTGAGCAATCAAAAAGATGAAGG + Intronic
934708169 2:96499290-96499312 ATGAACAACCAGTAGGACGTGGG + Intronic
936444698 2:112586411-112586433 CTGAACAACCAGAAGGATGAAGG - Intronic
936680036 2:114759612-114759634 CTTCACAACCAGAAGGTTGTGGG + Intronic
937771878 2:125728982-125729004 CTGACCAAACAGCAGGATGTGGG + Intergenic
937887962 2:126913235-126913257 ATGAAAAAGGAGAAGGATGATGG - Intergenic
938270253 2:129963957-129963979 CTGAACATCCAGAATTATGGAGG - Intergenic
939574099 2:143875124-143875146 CCAAACATCCAAAAGGATGAAGG - Intergenic
941690251 2:168494103-168494125 CTGCACAAACACAAGGGTGAAGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942244764 2:173997435-173997457 CTGAGCAGCCAGAAGCATGCAGG - Intergenic
943485359 2:188473182-188473204 CTGAACCACCAGAAGTAGGGTGG + Intronic
944503682 2:200388029-200388051 TTGAAGAAACAGAAGGATTATGG + Intronic
945144869 2:206727615-206727637 TTGAACAACCAGCTGGATGATGG - Intergenic
946107413 2:217383737-217383759 TGGAATAACCAGCAGGATGACGG + Intronic
948599257 2:239099155-239099177 CTCCACCAGCAGAAGGATGAAGG - Intronic
948881644 2:240860798-240860820 CAGAACAAGGACAAGGATGAGGG + Intergenic
1169275065 20:4228187-4228209 CCCTACATCCAGAAGGATGAGGG - Intronic
1171181873 20:23096968-23096990 ATGAACAACCAGAAAAATAAAGG - Intergenic
1173624888 20:44465576-44465598 CAGAACAAGCAGAAGAATAATGG - Intergenic
1173664315 20:44754013-44754035 CTGAACAACCACAGCGGTGATGG + Intronic
1174188204 20:48721918-48721940 CTGAGCAACCAGAAGGACAGAGG + Intronic
1177214394 21:18109632-18109654 CTGAATCTCCAGAAAGATGAGGG - Intronic
1177248505 21:18562625-18562647 CTGAACATCCAGAATTATGGAGG - Intergenic
1177801108 21:25829898-25829920 CAGAACACCCAGAAGAAGGAAGG - Intergenic
1178079163 21:29045245-29045267 CTGTAATACCAGAAGAATGAAGG - Intronic
1178387629 21:32166489-32166511 CTCAAAAAACAGAAGGATGGAGG + Intergenic
1179024855 21:37671430-37671452 ATGAGCAGCCAGAAGGAAGAAGG - Intronic
1179094440 21:38299686-38299708 CTGAGCAACCAACAGGAAGATGG - Exonic
1180838498 22:18945831-18945853 CTGAACATCCAGAATTATGGAGG + Intergenic
1180959757 22:19757201-19757223 CTGGTCAACCAGAAGGGCGACGG - Intronic
1181884098 22:26005529-26005551 CTGAAAAGCAAGAAGGAAGATGG - Intronic
1182851626 22:33479383-33479405 ATGAACAAACAGAAGGAAGAGGG + Intronic
1182881596 22:33738536-33738558 CTGCCCAACCAGGAGGCTGAGGG - Intronic
1183889600 22:40915698-40915720 CAGAATAGCCAGAAAGATGAAGG + Intronic
1184220139 22:43094660-43094682 CTGAGCACCTAGAAGGATTAGGG + Intergenic
1184541524 22:45128762-45128784 CTGACCTCCCAGAAGGAAGAGGG - Intergenic
1185050893 22:48553466-48553488 CTGGACACCCAGGAGGAGGATGG + Intronic
1185135374 22:49068262-49068284 GTGAACAACCGCAAGGATGCAGG + Intergenic
950030534 3:9849674-9849696 CTGAACATCCAGAATTATGGAGG - Intronic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
950944898 3:16934833-16934855 GTGAACAACCAGAGGGCTGAGGG - Intronic
951922477 3:27871648-27871670 AGAAACAACAAGAAGGATGATGG + Intergenic
952013783 3:28932926-28932948 CTGTACAACCAAAAAGATGATGG + Intergenic
955369179 3:58336283-58336305 CTGAGTCACCAGAAGGATGAAGG + Intronic
958021716 3:88005749-88005771 CTGAACAATGAGTACGATGATGG - Intergenic
958461124 3:94397254-94397276 ATGAAGACCCAGAAGGATGAGGG + Intergenic
959070635 3:101698997-101699019 CTGAACATCCAGAATTATGGAGG + Intergenic
960027577 3:113026269-113026291 CTGAACATCCAGAATTATGGAGG - Intergenic
961201991 3:125052739-125052761 CTGAACAGCCAGCAGGGTGACGG + Intronic
961297446 3:125897744-125897766 CTGAACATCCAGAATTATGGAGG + Intergenic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
962949183 3:140202440-140202462 CTAAACAACTGGAAGGATGGAGG + Intronic
963021754 3:140878627-140878649 CGGACCAATCAGGAGGATGAGGG + Intergenic
965013061 3:163121951-163121973 CTCATCAACCATAAGGCTGATGG - Intergenic
966846488 3:184134727-184134749 TTGAACTCTCAGAAGGATGAAGG - Intergenic
967026007 3:185564547-185564569 CTGAACATCCAGAATTATGGAGG - Intergenic
967081013 3:186049519-186049541 CTGAACAACCAGCAGAGAGAAGG - Intronic
967699119 3:192571004-192571026 CTGAAGAATCAGAAGGTTAATGG - Intronic
970424855 4:15936582-15936604 CTGAGCAGCCAGTAGGAGGAAGG + Exonic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
972674231 4:41243860-41243882 CTCAACATCCAGGAGGCTGAGGG + Intergenic
973769282 4:54191788-54191810 CTGAGCAACCAGAAGAATGCAGG + Intronic
973859778 4:55051713-55051735 CTAAACAATTAGAAGGAGGAAGG + Intergenic
974753194 4:66168413-66168435 GTGAAGAACAAGAAGAATGAAGG - Intergenic
977119775 4:93084522-93084544 GTGAATAAACAGAAAGATGAAGG - Intronic
977162036 4:93646857-93646879 CTGAACAAATAAATGGATGATGG + Intronic
977182629 4:93896076-93896098 CTGAGCTACTAGAAGAATGAAGG + Intergenic
977708158 4:100094249-100094271 CAGTAAAACCAGAAGGCTGAAGG - Intergenic
978714339 4:111823562-111823584 CTGAACAACCAGTTGAATTATGG + Intergenic
978884132 4:113745824-113745846 CTGAAATCCCAGAAGGATTAGGG - Intronic
979103285 4:116650702-116650724 GTGAACAACTAGGAGAATGAAGG + Intergenic
979441958 4:120760637-120760659 AGGAACAAACAGAAGCATGATGG + Intronic
980310390 4:131121758-131121780 CTGATCAACCAGAACAATGGTGG - Intergenic
980439949 4:132829361-132829383 CTGAGCAACTGGAAGGATAAAGG - Intergenic
980916161 4:139035091-139035113 CTGAGCGACCAGAAGGATGGAGG - Intronic
980939310 4:139258374-139258396 TTTAACAACCAGAATAATGAAGG - Intergenic
983618995 4:169739905-169739927 CTGAACAACATAAAGAATGATGG + Intronic
985230770 4:187814134-187814156 CTGATCAATCAGAAGGATAATGG + Intergenic
988380131 5:30488644-30488666 CTGAACATCCAGAATTATGGAGG - Intergenic
989954690 5:50343855-50343877 CTGAAAAATCACAAGGAAGAGGG - Intergenic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992966836 5:82011358-82011380 CTGAACAAAAAGAATGGTGATGG - Intronic
993958753 5:94270463-94270485 CTGAGCAAAAAGAACGATGAGGG + Intronic
995511816 5:112918241-112918263 AAGAACAACCAGTAGGAAGAGGG + Intronic
995706008 5:114990052-114990074 CTGACCAATCAGCAGGATGTGGG + Intergenic
995738999 5:115334838-115334860 CTGCCCAACCAGAGGGATGAGGG + Intergenic
996019189 5:118573307-118573329 GTGAACCACCAGAAGGAAGCTGG - Intergenic
996815704 5:127570342-127570364 CGGACCAATCAGCAGGATGAGGG + Intergenic
999471311 5:151857578-151857600 CTGGACACCCAGAAGGCAGAGGG - Intronic
999885672 5:155920332-155920354 TTGAGCAACTAGAAGGATGATGG + Intronic
999951853 5:156659705-156659727 CTGAACATCCAGAATTATGGAGG - Intronic
1000741702 5:164976432-164976454 GTGAACTACCAGAAGGGAGAGGG - Intergenic
1001192606 5:169644502-169644524 CTGAATAGCTAGAAGAATGAGGG + Intronic
1003358694 6:5402103-5402125 AAAAACAACCAGAAGGAGGATGG - Intronic
1004480794 6:16017602-16017624 CTCCCCAACCAGTAGGATGATGG - Intergenic
1004622242 6:17341274-17341296 CGGACCAACCAGCAGGATGTGGG - Intergenic
1005067844 6:21835721-21835743 CTAAACAACAAGAGGGATGTTGG - Intergenic
1005730328 6:28690943-28690965 CTGAACATCCAGAATTATGGAGG + Intergenic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1007620898 6:43213787-43213809 CTGAACGTAGAGAAGGATGAAGG + Exonic
1008494535 6:52119396-52119418 GTAAACAACCAGAAGTAGGATGG + Intergenic
1010338553 6:74720215-74720237 ATCAACAACCAAAATGATGAGGG - Intergenic
1010591606 6:77718936-77718958 CTGAACATCCAGAATTATGGAGG - Intronic
1012227949 6:96726410-96726432 CTGAGCCATCAGAAGAATGAGGG + Intergenic
1012533017 6:100261328-100261350 GTGGACAATCAGAAGGATGTGGG - Intergenic
1012945322 6:105459859-105459881 CTGAGTGACCAGAATGATGAAGG - Intergenic
1013105236 6:107021467-107021489 ATGAAGATCCAGAAGAATGAGGG - Intergenic
1013376361 6:109518964-109518986 CAGAACACCTAGAAGGAGGAGGG - Intronic
1014487918 6:122023469-122023491 GTAAACAATCAGAAGCATGAGGG + Intergenic
1015842047 6:137487605-137487627 CTGAATAACCAGGAGGAGAAAGG + Intergenic
1017126474 6:151069308-151069330 CTGTACAACCTGGAGGATTAGGG - Intronic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1018637714 6:165878903-165878925 TGGAACCACCAGAAGGAAGATGG + Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019976280 7:4584425-4584447 CTGAACATCCAGAATTATGGAGG - Intergenic
1019977216 7:4592929-4592951 CTGAACATCCAGAATTATGGAGG - Intergenic
1021105805 7:16638435-16638457 ATGAACAGCCAGATGGAAGAGGG + Intronic
1024025028 7:45402855-45402877 CTGAACAACCATGAGGAAGCAGG - Intergenic
1027479363 7:78675779-78675801 TTGGAAAACAAGAAGGATGATGG - Intronic
1028519931 7:91718626-91718648 CTGAAGAAGAAGAAGGATAATGG - Intronic
1028967914 7:96823426-96823448 CTGAAAATCCAGAAGTACGAAGG + Intergenic
1030417080 7:109258580-109258602 TTGGACAAATAGAAGGATGAAGG - Intergenic
1030847813 7:114443054-114443076 CTGACCTACCATAAGGATGTGGG - Intronic
1031239277 7:119217664-119217686 CTGAACAATCAGAAGTGGGAAGG - Intergenic
1032081713 7:128862248-128862270 CTGAAGGACCTGCAGGATGAAGG - Intergenic
1032675485 7:134126405-134126427 CTGTAAGGCCAGAAGGATGAGGG + Intergenic
1033141668 7:138832533-138832555 CTGAAAAACCTGGAGGAAGAAGG + Intronic
1034499114 7:151438872-151438894 CTGAACTCCCAGCAGGGTGATGG - Intronic
1035066394 7:156108327-156108349 CTGCAAAACCAGATGGATGCTGG - Intergenic
1035082296 7:156226907-156226929 CTGAGCCAGCAGAAGAATGAGGG + Intergenic
1036291829 8:7499874-7499896 CTGAACATCCAGAATTATGGAGG - Intronic
1036825543 8:11973014-11973036 CTTGGCAACCAGAAGCATGATGG + Intergenic
1037715156 8:21391363-21391385 CAGCAAAACCATAAGGATGATGG + Intergenic
1037804813 8:22053397-22053419 CTGAAGAAAAGGAAGGATGAGGG - Intronic
1038397604 8:27258613-27258635 CTGGAGAACCAGAGGGGTGAGGG + Intergenic
1038441780 8:27575677-27575699 CTGACCATCCAGCAGGAAGAGGG - Intergenic
1038670015 8:29575346-29575368 CTGAAACACCAGCAGGAGGAAGG - Intergenic
1038829365 8:31040152-31040174 ATGAGCAACCAGAAAGATGAAGG + Intronic
1041643961 8:60232284-60232306 CTGAACAAACAGAGCAATGATGG + Exonic
1043022622 8:75023311-75023333 TTTAACAGCCATAAGGATGACGG + Intronic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1045528899 8:102965348-102965370 ATGAACAACAAGGAGGGTGAGGG - Intronic
1047773957 8:128053811-128053833 CTGAGCAACCAGAAGGGTTGGGG + Intergenic
1048491265 8:134895978-134896000 CTGAACAACCAGAAGGATGGTGG - Intergenic
1055693122 9:78855671-78855693 CTGAAGAACCAGAAGTAGCAAGG + Intergenic
1056454665 9:86748313-86748335 TTTAACAACCAGGTGGATGATGG - Intergenic
1056647736 9:88429551-88429573 ATGAACAGCCAGATGGAAGAAGG + Intronic
1056651418 9:88467580-88467602 ATGAACAACAAGGAGGAAGATGG + Intronic
1058035904 9:100252531-100252553 CTGCACAAGTACAAGGATGAAGG + Intronic
1058780428 9:108328093-108328115 CTGAACAACCAGATATATAAAGG + Intergenic
1059253348 9:112906864-112906886 ATCAACACCCAGGAGGATGAGGG + Intergenic
1059322037 9:113477412-113477434 CTTAACCACCAGAAGTATGAGGG + Intronic
1060433056 9:123567148-123567170 CTGAACTGCCAGAAGTATGGGGG - Intronic
1061505053 9:131027081-131027103 CTAATGAACCAGAAGGAAGACGG + Intronic
1061921848 9:133786949-133786971 CAGAAAAACAAAAAGGATGATGG + Intronic
1187034285 X:15521642-15521664 CTGCAGAACCAGAAGGTTGCAGG + Intronic
1187348342 X:18488505-18488527 CTGGTCAACCAGAAAGAAGAAGG + Intronic
1187670916 X:21665144-21665166 CTGAAAGACCAGAGGGGTGAAGG - Intergenic
1188405047 X:29797480-29797502 TTTAACAAACAGAAGGATGAGGG - Intronic
1190018548 X:46850913-46850935 CTGAACATCCAGAAAGTTAAGGG + Intronic
1190191127 X:48278040-48278062 CTGATCAGGCAGAAGGATGGGGG + Intergenic
1192373378 X:70534379-70534401 TTGGGCAACCAGAAGAATGATGG + Intronic
1194406751 X:93505709-93505731 CTGACCAACCTGGAGTATGAGGG + Intergenic
1194758700 X:97768231-97768253 CTGAACAACCAAAAGAATCAGGG - Intergenic
1196320415 X:114333657-114333679 CTGAACAAACAGAACGAAGCTGG - Intergenic
1198517089 X:137420535-137420557 TTGAGCAACCAGATGGATGGTGG - Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic