ID: 936449277

View in Genome Browser
Species Human (GRCh38)
Location 2:112621351-112621373
Sequence CCTTAATTATGGTGGCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936449277_936449285 25 Left 936449277 2:112621351-112621373 CCACACTGCCACCATAATTAAGG No data
Right 936449285 2:112621399-112621421 CTGTGAAGCTGCCTGCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936449277 Original CRISPR CCTTAATTATGGTGGCAGTG TGG (reversed) Intergenic
No off target data available for this crispr