ID: 936454531

View in Genome Browser
Species Human (GRCh38)
Location 2:112662147-112662169
Sequence GCATTTAAGCTGGTCCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936454531 Original CRISPR GCATTTAAGCTGGTCCATCA TGG Intronic
900133803 1:1104745-1104767 GCATTCAAGCTGGTCGAGCCGGG + Intronic
902523032 1:17032689-17032711 GCACTTATGCTTGTCCAGCAGGG - Intronic
904376598 1:30085900-30085922 GCATCTGAGCTGGTTCATCTAGG - Intergenic
905847274 1:41242802-41242824 GCATTGTACCTGGCCCATCACGG - Intergenic
907230270 1:52991328-52991350 CCAGTTAAGCAGATCCATCATGG - Intronic
907324680 1:53629266-53629288 GCATTTGAGCTGGGCCTTGAGGG - Intronic
912149704 1:106842924-106842946 ACATTTAAGTTGATCCATAAAGG - Intergenic
912705072 1:111905545-111905567 GCATTTAAGATTGTCCCCCAGGG - Intronic
914454759 1:147825315-147825337 GCATTTGAGTTGGGCCTTCAAGG - Intergenic
916173709 1:162021139-162021161 GCATTTAATCTGGGCCTTGAAGG + Intronic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
922055870 1:222041943-222041965 GAATTCAAGCTGGTCCTTCAAGG + Intergenic
923466978 1:234257598-234257620 GCATTATAGCTGGTTCATTAGGG + Intronic
924367670 1:243313000-243313022 GAATTTAAGCAGTTCCATCTTGG - Intronic
1063005781 10:1969377-1969399 GCGGTTCAGCTGTTCCATCATGG + Intergenic
1064023607 10:11828953-11828975 GCATTTGAGCTGGGCCAACAAGG + Intronic
1065411588 10:25435389-25435411 GCATTTAACCTGTGCCCTCAAGG + Intronic
1066221680 10:33340993-33341015 GGATTAAAGCAAGTCCATCAAGG - Intergenic
1066577044 10:36837325-36837347 GCATTGAAACAGGTCCATCTTGG + Intergenic
1069316598 10:67111882-67111904 GCATTTAAGCTATTTCATTATGG + Intronic
1069792625 10:71032735-71032757 GCATTTAAACTGGGCCATGGAGG + Intergenic
1070807737 10:79280307-79280329 GCATTCCAGCTTGTCCAACAGGG - Intronic
1070807984 10:79281881-79281903 GCTATTTAGCTGGTCCTTCAGGG + Intronic
1072730110 10:97840584-97840606 GCATTTGAGCTTGGCCTTCAGGG - Intergenic
1074321906 10:112411030-112411052 GTTTTTAATGTGGTCCATCATGG + Intronic
1075770226 10:124928121-124928143 ACATTTAAGCTGGTCCTTGAAGG + Intergenic
1076110780 10:127857438-127857460 GCATTTCAGAAAGTCCATCATGG - Intergenic
1077454918 11:2672739-2672761 GCTTTTTTGCTGGTCCAGCATGG + Intronic
1078673209 11:13383546-13383568 TCATTTAAGATTGTCCATCATGG + Intronic
1079158142 11:17967919-17967941 GCATTTAAGCTAGGCCCTGAAGG - Intronic
1079290421 11:19183397-19183419 ACACTTAAGCTGGGACATCATGG - Intronic
1080210945 11:29784394-29784416 GCATTGAACCAGGTCCCTCAAGG + Intergenic
1080585117 11:33674786-33674808 GCTTTGAATATGGTCCATCATGG - Intergenic
1085021497 11:73213043-73213065 GCATTTGAGCTGGTTCATGGAGG + Intergenic
1090326743 11:125893971-125893993 GCATTTAGGACGGTCCATGAGGG + Exonic
1091453765 12:590216-590238 GCATTTTAGCAGGACCATGATGG + Intronic
1091665188 12:2413810-2413832 GCATTTGAGCTGGGCCTTAAAGG - Intronic
1092380214 12:7990001-7990023 ACATTTAAGCTGGACCTTGAAGG - Intergenic
1098633389 12:72751899-72751921 GTATTTCAGCTTGTGCATCAAGG + Intergenic
1101643001 12:106601917-106601939 GCATTTCAGCTGGTCCTTAAAGG - Intronic
1102769436 12:115462189-115462211 GAATATAAGATGGTCCAACAAGG - Intergenic
1106569749 13:30916043-30916065 GCATTTTAGAGGCTCCATCAGGG + Intronic
1110840303 13:80134472-80134494 GCAAATCAGCTGCTCCATCATGG + Intergenic
1113981096 13:114276686-114276708 GCATCGACGCTGGTCCCTCAGGG + Intergenic
1114268595 14:21087890-21087912 GCAACCAAGCTGCTCCATCAGGG - Intronic
1119628956 14:76209306-76209328 GCTTTTAAGTTGGTGCATTAAGG - Exonic
1120595039 14:86422888-86422910 GCCTTTAAGGTGGTACATTAAGG - Intergenic
1120714339 14:87824006-87824028 GCATTTAAGTTGGGCCTTGAAGG - Intergenic
1128724908 15:69981360-69981382 GCATTTAAGCTGGGCCCTAAGGG - Intergenic
1129647997 15:77455834-77455856 GCATTTCATATGGTCCATGAGGG - Intronic
1138526958 16:57614425-57614447 GCATTTGAACTGGGCCATAAAGG + Intronic
1140703443 16:77603890-77603912 GCATGTAAGTTGCTCCCTCAGGG + Intergenic
1140778434 16:78272235-78272257 GCACTTCAGCTGGTCCAGGATGG + Intronic
1141777609 16:86134700-86134722 GCATTTAAGCTGGGTCTTGAGGG + Intergenic
1148012538 17:44495006-44495028 GCATTTAAGCTGGATCTTGAAGG - Intronic
1149490477 17:57081494-57081516 GAATTTAACCTGGGACATCAAGG - Intergenic
1157789647 18:50520297-50520319 GGATATAAGCTGCTCCATGAGGG + Intergenic
1159314460 18:66753592-66753614 CCATTTAAGCTTTTTCATCAGGG - Intergenic
1162360166 19:10214966-10214988 GCATTTAAGCAGGTTCTTCCAGG + Intronic
1165818774 19:38660952-38660974 GCATTTCAGCTGTTCCTTAACGG + Intronic
1167373689 19:49100137-49100159 GCATTTGAGCTGGTCCCTAAAGG - Intronic
926203872 2:10821134-10821156 GGATTTCAGCTGGGCCATAAAGG - Intronic
927167359 2:20337604-20337626 GTATTTAAGCTGGGCCTTGAAGG + Intronic
930607224 2:53505050-53505072 TCATTTAATCTGGACCTTCAAGG - Intergenic
930779777 2:55212905-55212927 GCATTTCACCTAGTCCATAATGG - Intronic
933087966 2:78079911-78079933 GCCTTGATGCTGGTCCTTCATGG + Intergenic
936454531 2:112662147-112662169 GCATTTAAGCTGGTCCATCATGG + Intronic
936481971 2:112892604-112892626 ACATTTAAGCTGGGCCCTGAAGG + Intergenic
940033971 2:149293953-149293975 ACATTTAAGTTGGTCCCTGAAGG + Intergenic
943537621 2:189172061-189172083 CCACTTAAGCTGGTCTAGCATGG - Intronic
943751869 2:191517656-191517678 GCATTTAAGTTGGACCTTAAAGG + Intergenic
1169113964 20:3050739-3050761 CCAATTAATCTGTTCCATCAAGG + Intergenic
1169529816 20:6472921-6472943 CCATTTAACCTGGTCAATCAAGG - Intergenic
1170923429 20:20700925-20700947 GGAGTTGAGCTGGTCCGTCATGG - Intronic
1176955572 21:15099160-15099182 GCCTGTAAGCTGTGCCATCAGGG + Intergenic
1178069170 21:28942699-28942721 GCATTTAAACTGGACCTTTAAGG - Intronic
1178299895 21:31443568-31443590 GCATTTAAACTGGTCCTTGATGG - Intronic
1181422762 22:22813192-22813214 TCATTAAAGCTGTTCCTTCATGG - Intronic
1181582798 22:23837311-23837333 CCTTTTAAGCTTGTCCTTCACGG - Intronic
953778610 3:45844860-45844882 GCATTAAAGCAGGTCAAGCAAGG + Intronic
960317643 3:116197916-116197938 ACATTTAAGCTGGAACATAAAGG + Intronic
964933759 3:162057307-162057329 GCATTTAAGCTTGGCCTTGATGG - Intergenic
965811675 3:172597507-172597529 ACATTTAAGCTGGTACATTTTGG + Intergenic
976790173 4:88869555-88869577 TGATTTAAGCTGATACATCAGGG - Intronic
979499625 4:121424869-121424891 GCATTTGAACTGGTCTTTCAAGG + Intergenic
979788603 4:124749873-124749895 TCCTTTAAGATGTTCCATCAAGG + Intergenic
987474910 5:18379033-18379055 GAATTTAAACTGAACCATCAGGG + Intergenic
989476984 5:41884971-41884993 GCATATAAGCTGCTTCATCTGGG + Intergenic
989550030 5:42723691-42723713 GCATTAGAGCTGGGCCATGAAGG - Intergenic
999874639 5:155789520-155789542 TCATTAAAGCAGGTTCATCAGGG - Intergenic
1001233207 5:170007774-170007796 GCATCTCAGCTGGGCCAGCAGGG + Intronic
1003257786 6:4489328-4489350 GCCTTTAAACAGGTCCATTAGGG - Intergenic
1003303197 6:4903428-4903450 ACATTTAAGATGAACCATCACGG - Intronic
1006738742 6:36292832-36292854 GCTTTAAAGCTGGGACATCAGGG + Intronic
1011415995 6:87120766-87120788 GCATATTAGCAGGTCCATCCTGG + Intergenic
1012691155 6:102312769-102312791 GCATTTGAGCCGGTGCAGCATGG - Intergenic
1014103538 6:117538009-117538031 GCTTTTGAGCTTCTCCATCATGG + Intronic
1014537018 6:122626560-122626582 GCATTTGAGTTGGGCCATTAAGG + Intronic
1015177908 6:130331007-130331029 GAATATAAGCTGGTGCAACAGGG + Intronic
1020399518 7:7759678-7759700 AAATTTAAGCTGGTCCTTTAGGG + Intronic
1024112148 7:46158247-46158269 CCATCTCAGGTGGTCCATCAAGG - Intergenic
1027618994 7:80459781-80459803 GCTTTAAAGCTTGTCCTTCAAGG - Intronic
1034076988 7:148241599-148241621 GCATTTGAGCTGTTCCTTCAAGG + Intronic
1037196281 8:16194257-16194279 GCATTTATGCTGGTCCAGGCTGG - Intronic
1037585161 8:20270994-20271016 GAGTTTAACCTGGTCCCTCAGGG + Intronic
1039865792 8:41500314-41500336 ACATTTAAGCTGTTGCATGAAGG + Intronic
1043291504 8:78607447-78607469 ACATTTAATCTGGTTCACCATGG + Intergenic
1046799808 8:118413472-118413494 GAATTTAAGCTAGGCCATTAAGG - Intronic
1048482490 8:134812371-134812393 GCATTTGAACTGGTCCTTGAAGG - Intergenic
1053291523 9:36882558-36882580 GCATTTGAGCTGGTCTTTGAAGG - Intronic
1060141768 9:121216558-121216580 GCTTTTGAGCTGGGCCATGAAGG - Intronic
1061401386 9:130370254-130370276 CCTTTTAAGCTGGACCATAAAGG + Intronic
1061691150 9:132332324-132332346 GCATTTAAGCTGGACTTTTAAGG - Intronic
1185744148 X:2558126-2558148 GCATTTGAGTTGATCCATCTGGG - Intergenic
1190782681 X:53613385-53613407 GCATTTGAGCTGGTCCTGAATGG - Intronic
1191800838 X:65077489-65077511 GGAGTTAAGATGGCCCATCAGGG + Intergenic
1195111497 X:101655051-101655073 GCATTTAAGCTGAACCCTGAAGG - Intergenic
1195876238 X:109544955-109544977 GCATTTTAGCTGGTTTCTCAAGG - Intergenic
1196906749 X:120444502-120444524 GCATTTGAGCTGGGCCTTCAAGG - Intronic
1197996668 X:132383778-132383800 GCATCTATTCTGGTCCACCAAGG + Intronic
1198244104 X:134812711-134812733 GCATTTGAGATGGGCCTTCATGG + Intronic
1198406062 X:136313817-136313839 GCTTTTGAGTTGGTCTATCAAGG + Intronic
1200074334 X:153543760-153543782 CCATTCAATCTTGTCCATCAGGG - Intronic