ID: 936454891

View in Genome Browser
Species Human (GRCh38)
Location 2:112665485-112665507
Sequence AGGCAGTGCCAGAACTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 191}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936454891 Original CRISPR AGGCAGTGCCAGAACTCTGA GGG (reversed) Intergenic
901459441 1:9382951-9382973 AGGCAGTGCCAGCACACACAAGG - Intergenic
904277796 1:29395479-29395501 GGGCAGAGCCAGAACTCAGCGGG + Intergenic
904600195 1:31668724-31668746 AGGCAGAGCTTGAGCTCTGAAGG - Intronic
905118251 1:35660914-35660936 AGGCATTGCAAGACCACTGAAGG + Intergenic
906518210 1:46452062-46452084 AAGCAATGCCAGGACTCAGAGGG - Intergenic
906821946 1:48939311-48939333 AGGCTGTGCCTGAAGGCTGAAGG - Intronic
906956233 1:50377158-50377180 AGGCAGAGGCAGAATTATGAAGG + Intergenic
907508512 1:54940738-54940760 AGATAGTGAGAGAACTCTGAAGG - Intergenic
910132475 1:83925065-83925087 GGGCAGCGACAGAACCCTGAGGG - Intronic
911047595 1:93641279-93641301 AGGAAATGGCAGAACTCTGGGGG + Intronic
911111516 1:94192590-94192612 AGGAGATGCCAAAACTCTGATGG + Intronic
911581359 1:99636939-99636961 AGGCAGAGCCATCACTCTGAAGG - Intergenic
911973063 1:104461482-104461504 TGCCAGTACCAGAACTCTGAAGG - Intergenic
916842785 1:168616730-168616752 AGCCAGTGCCAGAAAACAGAGGG + Intergenic
917641786 1:176990011-176990033 AGGCAGTCCAAGAAAGCTGAAGG - Intronic
919784841 1:201252473-201252495 AGGCAGGGAGAGAAGTCTGAAGG + Intergenic
919944986 1:202312399-202312421 AGGAAATGCCAGGACTCTGTGGG + Intronic
921189393 1:212696376-212696398 GGGCAGTGCCAGGGCACTGATGG + Intronic
922538268 1:226399556-226399578 AGGCAGTGAAAGGACTCTGGAGG + Intronic
922666400 1:227473377-227473399 AGGCAATGCCATAACTCACAGGG + Intergenic
923285325 1:232489033-232489055 TGGCAGTGGCAGAGCCCTGAGGG + Intronic
1062913607 10:1230634-1230656 ATGCAGAGCCAGCTCTCTGAAGG + Intronic
1064760153 10:18610655-18610677 AGGAAGGGCCAGGACTCAGATGG + Intronic
1067937889 10:50626005-50626027 AGGGAGTGCCAGAAAACTGCTGG + Intergenic
1069891061 10:71652784-71652806 AGGCAGGGCCACAGCTCTGAGGG - Intronic
1071475272 10:86020130-86020152 GGGCACTGCCAGCCCTCTGAGGG - Intronic
1071963579 10:90830960-90830982 TGGCAGAGCCTGAACTCTGAAGG - Intronic
1072010535 10:91299252-91299274 AGGAAGTGCCAGACCTGGGAGGG - Intergenic
1072052353 10:91718187-91718209 TGGCAGAGCCAGAACTCGGAAGG - Intergenic
1074869665 10:117566835-117566857 GGGCTTTGCTAGAACTCTGAGGG + Intergenic
1075373676 10:121959458-121959480 AGGCAGAGTCAGAACTATGCAGG + Intronic
1076555070 10:131316220-131316242 AGGGAGTCCCAGGACTCGGAGGG - Intergenic
1076888983 10:133274866-133274888 AGGCTGTCCCAGAGCTCTGCAGG - Intronic
1077026708 11:442880-442902 AGGCAGGGCCAGAGCTCCGCAGG + Intergenic
1077524699 11:3057175-3057197 CGGCAGTGCCCGAGGTCTGAGGG - Intronic
1078618956 11:12890291-12890313 AAGCAAGGCCAGACCTCTGAGGG + Intronic
1078849389 11:15150144-15150166 AGGCCTAGCCAGAACACTGAGGG + Intronic
1080599040 11:33804026-33804048 AGGCAGAGCCAGAAATCTACAGG + Intergenic
1081659562 11:44879682-44879704 AGGCAGGGCCAGGTCACTGAGGG + Intronic
1081858219 11:46317112-46317134 AGGCAGTGCTAGAAGTAAGAGGG - Intronic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1084455656 11:69266748-69266770 AGGCAGAGACTGAACTCTGGAGG - Intergenic
1084497971 11:69516307-69516329 AGGCAGTGCAAGAAATCACATGG - Intergenic
1086290334 11:85301540-85301562 ATGCAGGGCTAGAACTGTGAGGG + Intronic
1089255920 11:117193818-117193840 AGGCAGGGACAGCAGTCTGAGGG - Intronic
1091230540 11:133985225-133985247 TGTCAGTGCCAAAACTGTGATGG + Intergenic
1091302133 11:134514578-134514600 GGGCATTGCCAGGACTGTGAAGG - Intergenic
1096054990 12:48642947-48642969 ATGGTGTGCCAGAACTGTGATGG - Intergenic
1097957803 12:65504429-65504451 CAGCAGTTCCAGAACTCTGAAGG - Intergenic
1098821142 12:75231810-75231832 AGGCAGTCTCATAAATCTGAGGG - Intergenic
1100241390 12:92713386-92713408 AGCCAGTGCCAGCACTCTACAGG + Intergenic
1101600034 12:106201382-106201404 AGTCAGTCCAAGAACTCTGTGGG - Intergenic
1102524206 12:113499717-113499739 AGGTAGTGCCAGATCACAGATGG + Intergenic
1103113348 12:118302304-118302326 AGGCAGTGCCAAAACCCTCCAGG - Intronic
1103532374 12:121611469-121611491 AGGCAGTGCCAGGAGCCTGGTGG + Intergenic
1104566431 12:129888990-129889012 AGGCAGGCCCAGAGCTTTGATGG + Intronic
1107833704 13:44396954-44396976 AGGCAGCCCCAGAACTTTGCTGG + Intronic
1109719951 13:66263168-66263190 AAGCATTGCTAGAACTCTGCTGG + Intergenic
1110562467 13:76923954-76923976 AGGAAGTGTGACAACTCTGACGG + Intergenic
1115057318 14:29145318-29145340 AGACAGTGCCAGGAGTCTGATGG - Intergenic
1115480632 14:33857846-33857868 GGGCAGAGCCAGATCTCAGAGGG - Intergenic
1115697373 14:35913739-35913761 ATCCACTGCCTGAACTCTGAAGG + Intronic
1117481334 14:56148414-56148436 AGGCAGGGCCTGTACTGTGAAGG - Intronic
1122297362 14:100713006-100713028 CGGCCATGCCAGAGCTCTGAGGG + Intergenic
1122871047 14:104639223-104639245 AGTCAGTGCCTGAACTCTGTCGG - Intergenic
1125254231 15:37744891-37744913 AGCCTGTGCCTGAACTCTGAGGG + Intergenic
1127133286 15:55890977-55890999 AGGCAGTGCCTGGTCACTGAGGG + Intronic
1127159294 15:56164618-56164640 AGGCAGTGCAAGCAGTCTGTTGG - Intronic
1130706970 15:86242535-86242557 AGGCAGTGACAGAAAGTTGAAGG + Intronic
1130725304 15:86432926-86432948 AGGCCCTGCCAGAACCCTGAGGG - Intronic
1132762917 16:1519699-1519721 AGGCTGTGCCCGGGCTCTGAGGG + Intronic
1136494546 16:30634346-30634368 GGGCAGTGCCAGTGCGCTGAAGG - Intergenic
1137591828 16:49698501-49698523 TGGCAGCGCCAGAAATCTGACGG - Intronic
1138337400 16:56264009-56264031 AGGCAGTGGCTGGAATCTGAGGG + Intronic
1138390889 16:56669313-56669335 AGGCAATGCCAGAGATCTGAAGG + Intronic
1140035951 16:71371473-71371495 AGGCTCTGCTAGAGCTCTGAGGG + Intronic
1141844631 16:86599032-86599054 GGGCAGGGCCAGAAGTGTGAGGG - Intergenic
1148888448 17:50790341-50790363 ATGCAGTGGCAGAGCTCAGATGG - Intergenic
1149208893 17:54280868-54280890 AGGCAGTGCCAGAAATAAGAAGG - Intergenic
1150052846 17:61981565-61981587 AGGCAGTGCAAAGACCCTGAGGG - Intronic
1151433126 17:74078386-74078408 TGGCAGTGACAGAGCTCAGAGGG - Intergenic
1151994107 17:77597825-77597847 CGGCAGTGCCACTACTCTGTAGG + Intergenic
1153478646 18:5524597-5524619 AGGCTGTGCCAGAGATCTCAAGG + Intronic
1156320570 18:36017671-36017693 AGGCATTCATAGAACTCTGATGG - Intronic
1156929030 18:42618543-42618565 ATCCAAGGCCAGAACTCTGATGG - Intergenic
1157108646 18:44798951-44798973 AGGCAGTGCTAGGCCTCTGCTGG + Intronic
1157368585 18:47089219-47089241 AGACAGGGCCAGAATTCTCAAGG - Intronic
1158899642 18:61950677-61950699 ACCCAGTGCCAGGGCTCTGAAGG - Intergenic
1159784908 18:72701839-72701861 ATGCATTTCCAGAACCCTGATGG - Intergenic
1159899909 18:74036405-74036427 AGGCAGGGGCAGAACTCTGCTGG - Intergenic
1162873883 19:13606550-13606572 ACACAGTGCAAGAACTTTGACGG + Intronic
1163592896 19:18204276-18204298 AGCCAGTGAGAGAACGCTGAGGG - Intergenic
1165059264 19:33196848-33196870 GGGTAGTGCCAGGACCCTGAAGG - Intronic
1165443490 19:35844138-35844160 CTGCACTGCCAGAACTCTGAGGG - Exonic
1168361893 19:55748227-55748249 AGGCAGTCCCAGAAATTTCATGG - Intergenic
926359416 2:12071547-12071569 AGGGAGGCCCAGAACTCTGGTGG + Intergenic
928641172 2:33301560-33301582 GGGCAGTGCAGGAACACTGAGGG + Exonic
928894320 2:36243391-36243413 AGAGAGTTCTAGAACTCTGAAGG + Intergenic
929777922 2:44939884-44939906 CCGCAGTGCCAGGCCTCTGAGGG - Intergenic
934504328 2:94879391-94879413 CTGCTGGGCCAGAACTCTGAGGG + Intergenic
934937990 2:98479037-98479059 AGGAAGTGCCCGACCTATGAAGG - Intronic
935341624 2:102064254-102064276 AGGAAGGGCCTGAAGTCTGATGG + Intergenic
935586209 2:104802159-104802181 AGGCTGGGCCAGAACACTGCAGG + Intergenic
936454891 2:112665485-112665507 AGGCAGTGCCAGAACTCTGAGGG - Intergenic
941591565 2:167426727-167426749 AGGCAGTGACAGAGCTCTCAAGG + Intergenic
941986930 2:171519536-171519558 AGGCAGTGCCCCAGGTCTGAAGG - Intergenic
943680117 2:190759621-190759643 AGTAAGTGCCAGAATTGTGATGG - Intergenic
944750466 2:202704100-202704122 AGACAGTGTCTGAACTCTAAAGG - Intronic
945165792 2:206943077-206943099 TGGCAATGCCATAACACTGAGGG - Intronic
945926261 2:215807668-215807690 AGTAACAGCCAGAACTCTGAAGG - Intergenic
946188479 2:217994854-217994876 AGCCAGAGCCAGAACTCAGTAGG - Intronic
946307591 2:218865048-218865070 TCTCAGTGCCAGAACTCTGGTGG - Intronic
947166940 2:227272163-227272185 TGACAGTGCCAGAATTCTGATGG + Intronic
947791021 2:232869402-232869424 GGGCGCTGACAGAACTCTGAGGG + Intronic
948591649 2:239054306-239054328 GGTCGGTGCCAGAACTCAGAGGG + Intronic
948692853 2:239717859-239717881 AGGCAGTGAGAGAAGCCTGAGGG - Intergenic
948761914 2:240197528-240197550 AGGCATTGCCACTACTCTGGTGG - Intergenic
948902136 2:240962136-240962158 AGGCAGCTCCAGAGCTCTGCAGG - Intronic
1170570514 20:17629730-17629752 TGCCAGTGCCAGAACTCAGTGGG - Intronic
1172161482 20:32871833-32871855 AGGTTGTGCCAGATCTTTGAGGG + Intronic
1172299284 20:33837542-33837564 AGGCAGTGCCAGAACTTGTAAGG + Intronic
1172535885 20:35672873-35672895 TCCCAGTGCCAGAGCTCTGATGG - Intronic
1174194584 20:48764027-48764049 AGTCAGAGCCTGGACTCTGATGG - Intronic
1176039658 20:63058718-63058740 AGGCAATGCCAGACCCCTGTTGG - Intergenic
1179086144 21:38219512-38219534 AGGCAGGGACAGAAGTCTGCAGG + Intronic
1179560074 21:42210175-42210197 AGTCCCTGCGAGAACTCTGATGG + Intronic
1181533495 22:23530311-23530333 GGGCAAAGCCAGATCTCTGAGGG + Intergenic
1184186512 22:42868724-42868746 AGGCCCTGCCAGATCTCTCACGG + Intronic
1184860583 22:47171327-47171349 GGGCAGTTCCAGCACCCTGAGGG + Intronic
1185050631 22:48552325-48552347 AGGCAGTGGCAGAAGTCTGATGG + Intronic
949245651 3:1923208-1923230 AGCCAGTGCCAGAGCTCTACAGG - Intergenic
949743015 3:7258202-7258224 GGGCAGTGGTAGAACACTGAAGG - Intronic
950548714 3:13654003-13654025 CGGCAGTGCCAGGACTCTGTGGG - Intergenic
952627443 3:35423657-35423679 ATGCAGTGGCAGAGCTCAGAAGG - Intergenic
956179686 3:66505501-66505523 AGGCAGTCCCTTACCTCTGACGG + Intergenic
957335555 3:78823590-78823612 AGGCAGGGTCAGACCTCAGAGGG - Intronic
958970437 3:100605326-100605348 AGTCAGAGCCAGAGCTCTGAAGG + Intergenic
960045648 3:113194955-113194977 AGACAGAGCCAGATCTGTGATGG + Intergenic
962757570 3:138477857-138477879 AGGCAGAGACAGAAAACTGACGG - Exonic
965020377 3:163221298-163221320 AGGCAGTGCCAGAAAACAAATGG - Intergenic
967853945 3:194102318-194102340 AGGCAGTGACAGATCTCAGATGG + Intergenic
968635418 4:1675919-1675941 AGGCAGTGCCTCAGCTCAGATGG + Intronic
969930952 4:10630013-10630035 CGGCAGTGCAAAACCTCTGAGGG + Intronic
971465072 4:26948712-26948734 AGGCATTTCCAGAATACTGAAGG - Intronic
971490517 4:27207614-27207636 AGCCAGTTCTAGAACACTGATGG + Intergenic
973151224 4:46890703-46890725 AGAAAGTGCAAAAACTCTGAAGG + Intronic
973534862 4:51871019-51871041 AGTCAGTGCCTGAACTAGGATGG + Intronic
974262596 4:59543978-59544000 AGCCAATGCCAGAGCTCTGCAGG + Intergenic
976464849 4:85355221-85355243 AGTCAGTGGCAGAACTGTGATGG + Intergenic
977071315 4:92391961-92391983 AGGACGTGACAGATCTCTGATGG + Intronic
977233603 4:94480682-94480704 AGGCAATGGCAGAGGTCTGAAGG - Intronic
978857377 4:113408624-113408646 AGGCATTGCCAGAACTCCTGGGG - Intergenic
980421439 4:132565997-132566019 AGGCAGTGGCAGAGCTCAGGGGG + Intergenic
981225678 4:142291053-142291075 AGGCACTGACAGAGTTCTGAGGG - Intronic
985221126 4:187706515-187706537 AGCCAGTGCAAAAACTCTGTAGG + Intergenic
990381848 5:55227061-55227083 CGGCAGTGCCAGCATTCTGTTGG + Exonic
993440431 5:87950348-87950370 AGGCAGCACCAGAAACCTGAAGG + Intergenic
995438726 5:112166205-112166227 GGTCACTGCCAGAACTCTGGTGG + Intronic
995900314 5:117058262-117058284 AGGCAGTGCAAGCATTCTCATGG - Intergenic
996458259 5:123709829-123709851 AGCCAGAGCTAGAAATCTGAAGG + Intergenic
997737821 5:136227434-136227456 AGGCAGTGACTACACTCTGAGGG + Intronic
998317814 5:141200431-141200453 AGGCAGTTCCAGACCTGGGAGGG - Exonic
998318760 5:141209564-141209586 AGGCAGTTCCAGACCTGGGAGGG - Exonic
998477926 5:142436911-142436933 AGGAAGTGACAGAAAGCTGAAGG - Intergenic
998876079 5:146600687-146600709 TGTCAGTGCCAGATCTATGATGG - Intronic
999263267 5:150250606-150250628 GGGAAGGGCCAGAACTCTGTGGG + Intronic
1000141103 5:158404201-158404223 AGGCAGGGGCAGAGCTCTCATGG + Intergenic
1001824817 5:174736107-174736129 AGGCAGTGCCCCAACTGGGATGG + Intergenic
1002191126 5:177478197-177478219 AGGCAGTGGCAGAATCATGAGGG + Intergenic
1004691142 6:17993074-17993096 AGGCTGGGCCAGCTCTCTGATGG - Intergenic
1005006228 6:21290141-21290163 AGGCATTGCCCAAACCCTGAGGG + Intergenic
1006116718 6:31779594-31779616 AGGCCATGCCATACCTCTGAGGG + Exonic
1007252591 6:40506001-40506023 AGGCTGGGCCTGAGCTCTGAGGG + Intronic
1007762301 6:44140119-44140141 AGTCAGTGCCAGAAGGCTGGTGG + Intronic
1008886646 6:56438199-56438221 AGGCAGGGCCATAACCCTGGTGG + Intergenic
1009558258 6:65203053-65203075 GGGCAGTGCCTGGACTCTCAGGG - Intronic
1009836864 6:69012440-69012462 AGGCAATTGGAGAACTCTGAAGG + Intronic
1011684590 6:89814236-89814258 TAGCTGTGCCAGAATTCTGAAGG - Intronic
1015918432 6:138242347-138242369 GGGCAGAGACAGAACTGTGAGGG - Intronic
1016263595 6:142205195-142205217 AGGCAGTGCTAGAACTCTTAAGG - Intronic
1016544252 6:145202680-145202702 AGGCAGTGACAGCACACTGAGGG + Intergenic
1017656276 6:156633014-156633036 AGAGGGTGCCAGAACTCTGGTGG - Intergenic
1018469095 6:164080598-164080620 AGGCTGTTCCAGAGCTCTGGGGG + Intergenic
1019642119 7:2109117-2109139 AGGCAGGGCCTGTCCTCTGATGG - Intronic
1019756023 7:2770832-2770854 AGGCAGTGCCAGTATTCCTATGG - Intronic
1020142923 7:5622363-5622385 AGGCACTGCCACAGCTGTGAGGG - Intronic
1023294851 7:38703931-38703953 AGGCAGCCCCAGATCTCTGGGGG + Intergenic
1023529549 7:41137990-41138012 AGGCATTGCCTGAATTCTGATGG - Intergenic
1023609582 7:41959283-41959305 AGACAGTGCAAGGTCTCTGAAGG + Intergenic
1028097602 7:86781391-86781413 AGCAAGTGCCAGAAATCTAAGGG - Intronic
1028173430 7:87627667-87627689 AGGGCGTTCCAGGACTCTGAGGG + Intronic
1032726383 7:134593217-134593239 AGGCAGAGGCAGAAATCAGAGGG - Intergenic
1033230453 7:139593590-139593612 AGGCACTGCCATCCCTCTGAAGG + Intronic
1034536827 7:151730631-151730653 AGGCAGTGTGAGGACTATGAGGG + Intronic
1035238970 7:157517723-157517745 AGGCAGTGCCAGGGCTCAGGGGG - Intergenic
1036185209 8:6616639-6616661 AGGCAGTGGCAGAAGCCAGAAGG - Intronic
1036787529 8:11697887-11697909 AGGGAATGCCAGATCTCTGGGGG + Intronic
1036791887 8:11726524-11726546 TGGCAGTGGCTGGACTCTGAGGG + Intronic
1037219915 8:16505724-16505746 AGGCTGTGTCAGAGCTCTGTGGG + Intronic
1039790938 8:40875148-40875170 AGGGAGAGCTAGAACTCTGAAGG - Intronic
1047310877 8:123690817-123690839 AGTCAGTGCCAGAGCACAGAGGG - Intronic
1047583409 8:126242076-126242098 AGACAGTACCAGAAATGTGAAGG - Intergenic
1048978955 8:139692809-139692831 AGGCAGTGCCAGGCCACTCATGG - Intronic
1050464969 9:5912557-5912579 AGGCTGTTACAGAACACTGAAGG - Intronic
1051457737 9:17279970-17279992 AGGCAGTGCCAGACATCACATGG - Intronic
1052659440 9:31409220-31409242 AGCAAGTGCAAGCACTCTGAGGG - Intergenic
1057271917 9:93656303-93656325 GGGCACTGACAGAACTCTCATGG + Intronic
1057334946 9:94148296-94148318 AGGCAGACCCACATCTCTGAAGG + Intergenic
1061246981 9:129405532-129405554 AGGCAAAGCCAGATCTTTGAGGG - Intergenic
1062578046 9:137217688-137217710 GGTCAGTGCCAGAGCTCTGGTGG + Intergenic
1186320714 X:8421411-8421433 AGTGAGTGGCAGAACTGTGAAGG + Intergenic
1187823815 X:23315111-23315133 AGGCAGTCCCAGAGCTCAGAGGG - Intergenic
1190549984 X:51570174-51570196 AGGGAGGGCCAGGACTCTAAAGG + Intergenic
1193790542 X:85810866-85810888 AGGATGTGCCAGAATTCAGAAGG - Intergenic
1197657371 X:129131762-129131784 AGCTAGTGCCAAGACTCTGAGGG + Intergenic
1199662236 X:150063515-150063537 ACTCTGTGCCAGAACTTTGAGGG + Intergenic
1199861870 X:151808230-151808252 AGGCAGTGAAAGACCACTGAAGG + Intergenic
1200683908 Y:6244055-6244077 AGGCAATGCCACAACTGTGGTGG + Intergenic
1200831598 Y:7691715-7691737 AGGCAATGCCACAACTGTGGTGG - Intergenic
1201048727 Y:9910331-9910353 AGGCAATGCCACAACTGTGGTGG - Intergenic