ID: 936459060

View in Genome Browser
Species Human (GRCh38)
Location 2:112698077-112698099
Sequence CAGAGGACAGAGAAGGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936459060_936459066 29 Left 936459060 2:112698077-112698099 CCTACCACCTTCTCTGTCCTCTG No data
Right 936459066 2:112698129-112698151 CTCCAGTTTCTTTATGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936459060 Original CRISPR CAGAGGACAGAGAAGGTGGT AGG (reversed) Intergenic
No off target data available for this crispr