ID: 936459066

View in Genome Browser
Species Human (GRCh38)
Location 2:112698129-112698151
Sequence CTCCAGTTTCTTTATGCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936459064_936459066 2 Left 936459064 2:112698104-112698126 CCTGTTTTTAGTTTCTTATATAT No data
Right 936459066 2:112698129-112698151 CTCCAGTTTCTTTATGCAAATGG No data
936459062_936459066 22 Left 936459062 2:112698084-112698106 CCTTCTCTGTCCTCTGAAATCCT No data
Right 936459066 2:112698129-112698151 CTCCAGTTTCTTTATGCAAATGG No data
936459061_936459066 25 Left 936459061 2:112698081-112698103 CCACCTTCTCTGTCCTCTGAAAT No data
Right 936459066 2:112698129-112698151 CTCCAGTTTCTTTATGCAAATGG No data
936459063_936459066 12 Left 936459063 2:112698094-112698116 CCTCTGAAATCCTGTTTTTAGTT No data
Right 936459066 2:112698129-112698151 CTCCAGTTTCTTTATGCAAATGG No data
936459060_936459066 29 Left 936459060 2:112698077-112698099 CCTACCACCTTCTCTGTCCTCTG No data
Right 936459066 2:112698129-112698151 CTCCAGTTTCTTTATGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936459066 Original CRISPR CTCCAGTTTCTTTATGCAAA TGG Intergenic
No off target data available for this crispr