ID: 936460977

View in Genome Browser
Species Human (GRCh38)
Location 2:112713634-112713656
Sequence AACCTGCTCAGCTCCCACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936460977_936460979 -9 Left 936460977 2:112713634-112713656 CCTCAGTGGGAGCTGAGCAGGTT No data
Right 936460979 2:112713648-112713670 GAGCAGGTTTGCCGTGGCCTTGG No data
936460977_936460985 24 Left 936460977 2:112713634-112713656 CCTCAGTGGGAGCTGAGCAGGTT No data
Right 936460985 2:112713681-112713703 TTCTGCCCCAGATCTTGCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936460977 Original CRISPR AACCTGCTCAGCTCCCACTG AGG (reversed) Intergenic
No off target data available for this crispr