ID: 936461009

View in Genome Browser
Species Human (GRCh38)
Location 2:112713811-112713833
Sequence CTGAGGATCGCGGAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936461009_936461016 -9 Left 936461009 2:112713811-112713833 CCCTCCACCTCCGCGATCCTCAG No data
Right 936461016 2:112713825-112713847 GATCCTCAGATGCTTCCCTGGGG No data
936461009_936461015 -10 Left 936461009 2:112713811-112713833 CCCTCCACCTCCGCGATCCTCAG No data
Right 936461015 2:112713824-112713846 CGATCCTCAGATGCTTCCCTGGG No data
936461009_936461020 8 Left 936461009 2:112713811-112713833 CCCTCCACCTCCGCGATCCTCAG No data
Right 936461020 2:112713842-112713864 CTGGGGAGACACGACCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936461009 Original CRISPR CTGAGGATCGCGGAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr