ID: 936461957

View in Genome Browser
Species Human (GRCh38)
Location 2:112720920-112720942
Sequence CCTCCCTCAAAGGGGCTCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936461948_936461957 -7 Left 936461948 2:112720904-112720926 CCTGTCCTGGCTGACTCCTCCCT 0: 1
1: 3
2: 2
3: 37
4: 482
Right 936461957 2:112720920-112720942 CCTCCCTCAAAGGGGCTCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 128
936461947_936461957 -1 Left 936461947 2:112720898-112720920 CCAGAGCCTGTCCTGGCTGACTC 0: 1
1: 0
2: 1
3: 36
4: 276
Right 936461957 2:112720920-112720942 CCTCCCTCAAAGGGGCTCGGGGG 0: 1
1: 0
2: 0
3: 14
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936461957 Original CRISPR CCTCCCTCAAAGGGGCTCGG GGG Intergenic
900094666 1:935438-935460 CCTGCCTCAAAGGGGGTCGAGGG - Intronic
900408947 1:2504264-2504286 CCACCCTCCCAGGGGCTCCGTGG - Exonic
901291963 1:8131132-8131154 CCTCACTCAAAGGGGGACAGTGG - Intergenic
901631679 1:10651139-10651161 CCTCCCTCCAGGGGGCACGGCGG - Intronic
904473295 1:30748802-30748824 CCTCCCTCCACTGGGCTCTGGGG + Intronic
907333533 1:53686366-53686388 CCTCCATCAGAGAGGCTAGGGGG - Intronic
907850938 1:58254324-58254346 CCTCTCTCAAAGGAGGTGGGTGG - Intronic
910093124 1:83488765-83488787 CCTCCCTAAAAGGGGAGCGATGG - Intergenic
916785019 1:168080581-168080603 CCTGCCTCTTAGGGGCTTGGAGG + Exonic
916889835 1:169104974-169104996 CCTCCCCCACTGGGGCTTGGTGG + Intergenic
920418575 1:205814198-205814220 CCTCCCTGAAAGTAGCCCGGGGG + Intergenic
1063486958 10:6429116-6429138 CCACCCTCCAAGGGGCCCTGGGG + Intronic
1064771571 10:18728961-18728983 CATTCCTCAAAGGGTCTTGGGGG + Intergenic
1065722533 10:28640700-28640722 CCTCCCTATGAGGGGGTCGGGGG + Intergenic
1065798634 10:29330947-29330969 CCCACCTCAAAGGGGCTGGAGGG - Intergenic
1070776718 10:79114050-79114072 CTGCCCTCAGAGGGGATCGGGGG - Intronic
1075571959 10:123552657-123552679 CCTCCCTCAAAGGGACTGTAAGG - Intergenic
1076674918 10:132142702-132142724 CCTCCCTTACTGAGGCTCGGAGG + Intronic
1076917743 10:133432961-133432983 CCTCCCTCACCGGCGCTCGGGGG + Intergenic
1076937739 10:133577036-133577058 CCTTCCTCACCGGTGCTCGGGGG + Intergenic
1077198065 11:1291446-1291468 GTTCCCTCAGAGGGGGTCGGGGG - Intronic
1077340590 11:2024683-2024705 CCTTCCTCCAAGGTGCTCTGGGG + Intergenic
1081713678 11:45233914-45233936 CCTCCCTCACAGAGGCCCCGTGG + Intronic
1081937896 11:46917772-46917794 GCTCCCACCAAGGGGCTCTGGGG - Intronic
1083397232 11:62400231-62400253 CCTCCCTCAAAGGTCCTCACAGG + Intergenic
1084446030 11:69204280-69204302 CCTCCCTGAGAGGTGCTGGGTGG - Intergenic
1084946602 11:72642162-72642184 CCTCCCTGAGAAGGGTTCGGGGG + Intronic
1085519903 11:77131639-77131661 CCTCCCTCAGGGGGCCTCTGAGG + Intronic
1087009192 11:93497565-93497587 CCTCCCTCAAAGGAACACTGAGG + Intronic
1089467284 11:118693444-118693466 CCTCCACCAAAGGGGCTTTGTGG + Intergenic
1202823575 11_KI270721v1_random:79872-79894 CCTTCCTCCAAGGTGCTCTGGGG + Intergenic
1091918738 12:4287839-4287861 ACTCCTTCAGAGGGGCTGGGTGG - Intronic
1092247317 12:6871024-6871046 CCTCCCTCCAAGTGGCTCTGGGG + Exonic
1096525606 12:52208238-52208260 CCTCCCTGCAAGGGGCCAGGAGG - Intergenic
1096704342 12:53409350-53409372 CCTCACTTTCAGGGGCTCGGGGG + Exonic
1101878512 12:108610832-108610854 TCTCCCTCTCAGGGGCTTGGAGG + Intergenic
1104638051 12:130450156-130450178 CCCCACTCACAGGGGCTCGGTGG + Intronic
1104969169 12:132523435-132523457 CATGCCACAGAGGGGCTCGGTGG - Intronic
1105728241 13:23186650-23186672 CCATCCTCACAGGGGATCGGGGG + Intronic
1106104371 13:26721454-26721476 GCTCCCTGGATGGGGCTCGGGGG + Intergenic
1106475746 13:30096666-30096688 CCTCCATCAATGGGGCAGGGAGG - Intergenic
1113579407 13:111418466-111418488 CTTCCCTCAAAGGAGCTCTGGGG + Intergenic
1122824650 14:104363701-104363723 ACTCCCTCAAAAGTGCTCCGTGG - Intergenic
1124396083 15:29303114-29303136 ACTCCTTCACAGGGGCTGGGTGG + Intronic
1124398542 15:29328502-29328524 CCTCACTGAAAGGGGTTGGGGGG + Intronic
1128543328 15:68551628-68551650 GGTCCCTCACAGGGGCTCTGGGG - Intergenic
1133173559 16:3997339-3997361 CTTCCCTCAGAGGGGCTGGAAGG + Intronic
1133298093 16:4765437-4765459 CTTTCCTCAAAAGGGCTCAGGGG + Intronic
1134111560 16:11518337-11518359 CCTCCCTGACAGGGCCTCGGTGG - Intronic
1134302497 16:13004165-13004187 CCTCCCTCAAAGGGGATATAGGG + Intronic
1134487227 16:14668076-14668098 CCTTCCTCACAGGGACTAGGAGG + Exonic
1136026021 16:27469615-27469637 CCTCCCTCAAGAGGCCTCTGTGG + Intronic
1136933368 16:34437358-34437380 CCTCCCGGGAAGGAGCTCGGAGG + Intergenic
1136971204 16:34974456-34974478 CCTCCCGGGAAGGAGCTCGGAGG - Intergenic
1137600791 16:49754857-49754879 CCTCCCTCAAAGGGCCCCCTGGG + Intronic
1140580333 16:76223847-76223869 CCTCCCTCAGAGATGATCGGTGG - Intergenic
1141809759 16:86368001-86368023 GCTGCTTCAAAGGGGCTCGGGGG + Intergenic
1141900072 16:86985278-86985300 CCTCCCTCCAAGGGCCTCCAGGG + Intergenic
1142409857 16:89910482-89910504 CCTCCCTCGCAGGGACACGGAGG - Intronic
1142688259 17:1590417-1590439 CCTCCCAGAAAGTGGCACGGTGG - Intronic
1143254367 17:5544552-5544574 AGACCCTCAAAGGTGCTCGGAGG - Intronic
1144779185 17:17799409-17799431 CCTCCCTCAGAAGGGCACAGAGG - Intronic
1145258119 17:21338710-21338732 CCGCCCACCAAGGGGCTCTGTGG - Intergenic
1145318515 17:21749296-21749318 CCGCCCACCAAGGGGCTCTGTGG + Intergenic
1146279137 17:31533787-31533809 CCTCCCTCTAAGGGGCGCCATGG + Exonic
1147249065 17:39142193-39142215 CCTCCCTCAATGGGGCAAGGGGG - Intronic
1148438903 17:47701738-47701760 CCACCCTATAAGGGGCTAGGAGG + Intronic
1152462674 17:80449707-80449729 CCTCCCCCACAGGGCCTCGTGGG + Intergenic
1152809537 17:82375055-82375077 CCTCCTTCAAGCGGGCCCGGCGG + Exonic
1153250461 18:3116702-3116724 CCACCCTTAAAGGGACTCAGTGG - Intronic
1154219783 18:12441865-12441887 CTTCCATCAAACGGGCTCCGAGG + Intergenic
1155221446 18:23689633-23689655 CCGTCCGCAGAGGGGCTCGGGGG - Exonic
1161743977 19:6043436-6043458 CCTCCCTAAAAGGAGCCCTGAGG - Intronic
1162780095 19:13002401-13002423 CCGCCCTCAGAGGGGCTCCTCGG - Intronic
1163323587 19:16588767-16588789 CCTCTCTCAATGGGCCTCTGAGG - Intronic
1164454273 19:28394222-28394244 CAGCCCTCAAAGGGGGTGGGTGG - Intergenic
1165172953 19:33906388-33906410 CCTCCCCCACCGAGGCTCGGCGG - Intergenic
926300577 2:11599270-11599292 CTTCCCTGAAAGAGGCTCCGTGG + Intronic
927091760 2:19717820-19717842 CCTTCCCCCAAGGGGCTGGGTGG + Intergenic
930327189 2:49934596-49934618 CTTCCCTCTAATGGGCTCAGAGG - Intronic
934520999 2:95020198-95020220 CCTCACTCTAAGGGGCGGGGGGG + Intergenic
935279678 2:101506560-101506582 CCTCCCTCATAAGGGCCAGGTGG - Intergenic
936076463 2:109404681-109404703 CCTTCCGCAAAGGTGCTGGGAGG - Intronic
936461957 2:112720920-112720942 CCTCCCTCAAAGGGGCTCGGGGG + Intergenic
937472623 2:122187078-122187100 TCTCCCTCACAGGGCCTGGGTGG - Intergenic
938017934 2:127883558-127883580 TGTCCCTCAGAGGGGCTGGGAGG + Intronic
939619618 2:144402432-144402454 GGTCCCTCAATGGCGCTCGGCGG - Intronic
942825159 2:180167041-180167063 CCTCCCTTGAATGGGCTTGGTGG + Intergenic
947999869 2:234558990-234559012 CCTGCCTCACAGGGGTTCTGAGG + Intergenic
948204765 2:236157645-236157667 CCTCCCTCAAAGGTGCCTGGTGG - Intergenic
949057447 2:241936389-241936411 CCTCCCTCACAGGCCATCGGAGG - Intergenic
949072245 2:242032822-242032844 CCTGCCTCATAGGGCCTCTGAGG + Intergenic
1169987402 20:11460739-11460761 CCTCCCTCAAAGGCGCTTGCTGG + Intergenic
1170402261 20:16000413-16000435 CCTCCCTTAAAGGGGCCCCAAGG + Intronic
1170625001 20:18023591-18023613 CCTCCCTTGAATGGGCTCTGTGG - Intronic
1172183492 20:33017578-33017600 CCTCCCTGAAGGCTGCTCGGAGG + Intronic
1172272200 20:33660960-33660982 CCACCCTGAGAGGGGCTGGGAGG - Intronic
1172993245 20:39051133-39051155 CCTCCCTCAAAATTGCTCAGAGG - Intergenic
1173441899 20:43085162-43085184 CCTTCCTCAAAGCAGCTAGGAGG + Intronic
1173755660 20:45513669-45513691 CCTGCCCCAGAGGGGCTCAGTGG - Intronic
1176067130 20:63203715-63203737 ACTCCCTCAATGAGGCTCCGTGG - Exonic
1176246990 20:64102176-64102198 CCTCCCTCCAGGGGGCGCTGTGG + Intergenic
1179623991 21:42637952-42637974 CCTCCTGCAATGGGGCTGGGCGG - Intergenic
1180699044 22:17771895-17771917 CCTCCCTCCCAGGGGCTCACAGG + Intronic
1180964025 22:19776343-19776365 CCTCCCTCACTGGGGGTGGGAGG + Intronic
1183384520 22:37507373-37507395 CCTCACACAAGGAGGCTCGGGGG + Intronic
1184098924 22:42331364-42331386 CCTCCCTGATAGGGCCTCTGAGG - Intronic
1185289053 22:50014933-50014955 CCTTCCCCAGAGCGGCTCGGAGG + Intergenic
951333525 3:21393840-21393862 CCTGCCCCAGAGGGGCTGGGGGG + Intergenic
952503825 3:33989419-33989441 CCTCCCACAAAGGAGCTCAAAGG + Intergenic
959107345 3:102079636-102079658 CCTCCCTTAAGGGCACTCGGTGG - Intergenic
961388156 3:126536123-126536145 CCTACCTCCTAGGGGCTTGGTGG - Intronic
967970259 3:194994210-194994232 CCTCCGTGAGAGGGGCTGGGAGG - Intergenic
969511343 4:7619714-7619736 TCTCTCTCAAGGAGGCTCGGAGG + Intronic
983212984 4:164977576-164977598 CCTTCCTCGCGGGGGCTCGGTGG - Exonic
985069019 4:186150252-186150274 CCTCCCTCCAAGGGTCTCCGTGG + Intronic
985484202 5:139800-139822 CGTCGCTCCACGGGGCTCGGTGG - Intergenic
988680897 5:33482659-33482681 CTGCTCTCAAAGGGGCTTGGAGG + Intergenic
995083080 5:108076791-108076813 CCTCCCTCAGAGGGAATAGGTGG - Intronic
998364924 5:141623618-141623640 CCTCACTCAGAAGGGATCGGGGG + Intronic
998849218 5:146338348-146338370 CCTCCCTCAACCGCGCTCCGGGG - Intronic
999232546 5:150070141-150070163 CCTCCCTCACCTGGGCTCAGGGG - Intronic
1002055267 5:176595116-176595138 CCTCCCTCAGAGGGTTTCAGTGG + Intronic
1002614553 5:180442744-180442766 CCTCTCTCTAAGGGGCCTGGAGG - Intergenic
1006748398 6:36361226-36361248 CGGCCCTCAAAGGACCTCGGTGG - Intronic
1019540916 7:1550611-1550633 CCTCCGTGAGAGGGGCTCGGTGG - Intronic
1019769679 7:2875971-2875993 CCTCCCTCCAAGAGGCTGTGTGG + Intergenic
1020106594 7:5424973-5424995 CCTCCCTGGAGGGGGCGCGGCGG - Intronic
1021039118 7:15839519-15839541 CCTTCCTTAACGGGGCTCTGGGG - Intergenic
1027309984 7:76945283-76945305 CCTCCCTAAAAGGGGAGCGATGG - Intergenic
1038777318 8:30542836-30542858 CCACCCTCAGAGGGGCTGGGAGG - Intronic
1039888881 8:41671262-41671284 CCTCCTTCAAAGGGGGTAAGTGG + Intronic
1040429458 8:47324667-47324689 CTTCCCTTAAAGGGGCTCTTTGG + Intronic
1042484194 8:69333481-69333503 CCTGCCTCATAGGGTCTCTGAGG + Intergenic
1047231594 8:123002300-123002322 CCTCCCACAAAGGGCCGGGGTGG + Intergenic
1049243024 8:141548376-141548398 CCTCCCTCTCTGGGGCACGGAGG - Intergenic
1049302732 8:141880260-141880282 CCTCCCTGGAAGGGGGTGGGAGG - Intergenic
1050387557 9:5106877-5106899 CATCACACAAAGGGGCCCGGGGG + Intronic
1050486006 9:6135308-6135330 CCTTCCTCAGAGGGCCTCAGAGG + Intergenic
1057271765 9:93655688-93655710 CCTCCATGGAAGGGGGTCGGGGG - Intronic
1057879159 9:98780155-98780177 CCTGTCTTAAAGGGGCTTGGGGG - Intronic
1062433771 9:136537098-136537120 ACTCCCTCTAGGGGGCTCTGTGG + Intronic
1198127415 X:133659617-133659639 CCTCCCTCAAGGAGGCTGTGAGG + Intronic