ID: 936462333

View in Genome Browser
Species Human (GRCh38)
Location 2:112722637-112722659
Sequence TGAGGGTCCCAGCTCTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 270}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936462331_936462333 -8 Left 936462331 2:112722622-112722644 CCTGAGTTCCGGAGCTGAGGGTC 0: 1
1: 0
2: 0
3: 9
4: 111
Right 936462333 2:112722637-112722659 TGAGGGTCCCAGCTCTGTCCTGG 0: 1
1: 0
2: 2
3: 27
4: 270
936462322_936462333 28 Left 936462322 2:112722586-112722608 CCTGGTGGGTGGAGGGTTGGGGG 0: 1
1: 1
2: 38
3: 95
4: 836
Right 936462333 2:112722637-112722659 TGAGGGTCCCAGCTCTGTCCTGG 0: 1
1: 0
2: 2
3: 27
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936462333 Original CRISPR TGAGGGTCCCAGCTCTGTCC TGG Intronic
900201999 1:1412132-1412154 TCGAGGTCCCAGGTCTGTCCAGG + Intergenic
900371173 1:2332868-2332890 CGAGGGGCCAAGCTCTGTCGGGG + Intronic
900619177 1:3579152-3579174 TGTGGCTTCCTGCTCTGTCCCGG - Intronic
900895188 1:5478498-5478520 CGAGGCTCCCAGTTCTGTTCGGG - Intergenic
901196066 1:7440352-7440374 GGACTGTCCCAGCTCTGCCCTGG - Intronic
901198074 1:7451421-7451443 GGAGGGTCACAGCTCTGCCTGGG + Intronic
901604893 1:10451451-10451473 TGAGGGGCCCGGCACTGGCCTGG - Exonic
902415417 1:16236104-16236126 TGTGGAGCCCAGCTCTGGCCAGG - Intronic
903183408 1:21616679-21616701 GCAGGGTCCCTGCTCTGTGCTGG + Intronic
903355244 1:22742378-22742400 TGAGAGCCGGAGCTCTGTCCAGG + Intronic
905663158 1:39744160-39744182 TGAGTGTCTCAGCTCTGCTCAGG + Intronic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
906652156 1:47520606-47520628 TCTTGGTCCCAGCTCTGCCCTGG - Intergenic
912451078 1:109768186-109768208 AGAGTTTCCCAGCTCTGACCAGG - Intronic
915016430 1:152738146-152738168 TATGGGGCCCAGCCCTGTCCTGG + Intronic
915123614 1:153648249-153648271 TAAGGGTCCCAGAGCTGTCCAGG - Intergenic
915311640 1:155008344-155008366 TGAGGGCCCCAGCCCAGTACAGG + Intronic
915509704 1:156379870-156379892 TGAGGTTCCCAGGTCCATCCTGG - Intronic
915784668 1:158596959-158596981 TCAGATTCCCATCTCTGTCCTGG - Intergenic
919381772 1:196869355-196869377 TGCAGTTCCCACCTCTGTCCTGG + Intronic
922483737 1:225957399-225957421 GGAGGGTCCCAGCTGGGGCCTGG + Intergenic
922548675 1:226477613-226477635 TGAGGGTACCTGCTTTTTCCTGG - Intergenic
922863870 1:228842312-228842334 TGAAGCTCCCAACTGTGTCCTGG + Intergenic
923194741 1:231654076-231654098 CCATGGTCCGAGCTCTGTCCTGG + Intronic
923198736 1:231691860-231691882 TGAGGCTCCCTGCAGTGTCCGGG - Intronic
1063135528 10:3213319-3213341 TGAGGCTCCGAGCCCTGACCTGG - Intergenic
1066406758 10:35126540-35126562 CGAGCGTCTCACCTCTGTCCAGG - Intergenic
1067441283 10:46310378-46310400 CCAGGGTCCCAGCTGTGTGCAGG + Intronic
1067577949 10:47419701-47419723 CCAGGGTCCCAGCTGTGTACTGG + Intergenic
1067577969 10:47419767-47419789 CCAGGGTCCGAGCTCTGTGCAGG + Intergenic
1067577988 10:47419833-47419855 CCAGGGTCCGAGCTCTGTGCAGG + Intergenic
1071360079 10:84837832-84837854 TCAGGGTGCCACCTTTGTCCTGG - Intergenic
1073347000 10:102791094-102791116 TGAGGGCGCCAGCTTTGTACTGG + Intronic
1073497938 10:103911318-103911340 TGATGGTCCCAGGGCTGTCCTGG + Intronic
1073726131 10:106233125-106233147 AGAGAGTCCACGCTCTGTCCTGG - Intergenic
1073782730 10:106857142-106857164 TGATTGTGCCAGCACTGTCCTGG - Intronic
1074157312 10:110810308-110810330 TGAGGGAAGCAGCTCTGACCTGG - Intronic
1075405958 10:122195905-122195927 TGTGGGGCCCAGAGCTGTCCAGG - Intronic
1075604243 10:123792896-123792918 TGTGGGTCCCAGCTCTGCTCTGG - Intronic
1075635535 10:124027803-124027825 TTTGGGTCCCAGCCCTGCCCTGG - Intronic
1076334009 10:129692846-129692868 TGAGGGTGGCAGCTCCCTCCAGG - Intronic
1076687403 10:132204316-132204338 GGAGGGTCTGAGCTGTGTCCCGG + Intronic
1076907126 10:133368396-133368418 TCAGGGTCTCAGCTCCCTCCTGG + Intronic
1076941501 10:133613070-133613092 GCAGGGTCCCAGCCCTGGCCTGG - Intergenic
1077181815 11:1220300-1220322 TGAGGGTCCCAGCTCTGCCATGG + Intergenic
1077197941 11:1290761-1290783 TCTGGCTCTCAGCTCTGTCCCGG - Intronic
1077356885 11:2122809-2122831 TGTGGGTGCCAGCCCTGGCCTGG + Intergenic
1077471267 11:2761777-2761799 CCAGGCCCCCAGCTCTGTCCAGG - Intronic
1077509763 11:2952058-2952080 CCAGGTTCCCAGCTGTGTCCAGG - Intronic
1079318802 11:19432661-19432683 TGGGGGCCCCAGCTCCTTCCTGG - Intronic
1080269565 11:30436744-30436766 TGTGAGTCCCAGCAGTGTCCAGG - Intronic
1084265476 11:68003408-68003430 TGACGGTGGCAGGTCTGTCCGGG + Intronic
1084317617 11:68354512-68354534 GGAGGGTCTGGGCTCTGTCCAGG + Intronic
1085527948 11:77174946-77174968 GGAGGGTCCCAGCTTTGGCTGGG + Intronic
1085643885 11:78210120-78210142 TGAGGGCTCCCGCTCCGTCCTGG + Exonic
1085702997 11:78761805-78761827 TGAGGATCCCAGCTTTATGCAGG + Intronic
1085753031 11:79178512-79178534 TGAGGGTCTCTGCTCTCCCCTGG - Intronic
1087776735 11:102263434-102263456 TGATGGTCCCATCTCTTTGCAGG + Intergenic
1089314624 11:117583163-117583185 AGAGGGTCCCAGACCTGTCCAGG - Intronic
1093519906 12:20036719-20036741 TGTGGGTCCCAGCTCTGTGGTGG + Intergenic
1095360883 12:41337389-41337411 TTAGGGTCACAGCTCTGACCTGG - Intronic
1095566865 12:43634365-43634387 TGAGGGAGCCAGCTATTTCCTGG + Intergenic
1096168487 12:49446500-49446522 TGAGGTTCCCAGTTCCTTCCTGG + Intronic
1096913713 12:55009871-55009893 TGTGGGTACCAGCTGTGGCCAGG - Intergenic
1097032780 12:56101563-56101585 AGTGGGTCTCAGTTCTGTCCTGG + Exonic
1097175998 12:57143229-57143251 ACAGGATCCCAGCTCTGGCCTGG - Intronic
1101532797 12:105589883-105589905 TGACGGACCCATCACTGTCCTGG + Intergenic
1101965022 12:109276643-109276665 TGTGGCTCCCAGCCCTTTCCTGG + Intergenic
1102610747 12:114109970-114109992 TGATGGTATCAGCACTGTCCTGG - Intergenic
1105316179 13:19266180-19266202 TGATGGCCCCAGTTTTGTCCTGG + Intergenic
1105614956 13:22003261-22003283 TGAGGGGCCAAGCTCTGTGCTGG + Intergenic
1105956382 13:25287175-25287197 TCAGGGGCCCTGCTCTGACCCGG - Intronic
1106480523 13:30133798-30133820 TGGGGCTCCCAGCTCTGGCCCGG - Intergenic
1110922550 13:81106735-81106757 TGAGGGTCCCAGCCATTTACAGG - Intergenic
1111594935 13:90399495-90399517 AGAAGGTCCTAGCTCTGTCTTGG - Intergenic
1112337691 13:98528143-98528165 TGATGGGCCCGGGTCTGTCCTGG - Intronic
1113432370 13:110261955-110261977 GGTGGGTCCCAGCTGTGACCGGG + Intronic
1116961494 14:50972797-50972819 TGTTGGTCCCATCTCTGTTCTGG - Intergenic
1118157901 14:63258621-63258643 TGAGGGTACCAGCCATGCCCTGG + Intronic
1119807630 14:77492459-77492481 AGAGTGACCCAGCTCTGTCTTGG - Intronic
1121096363 14:91220549-91220571 TGGAGGCCCCAGCTCTGTCTTGG - Intronic
1122471751 14:101972545-101972567 TGAGCGCTCCAGCTCTGCCCTGG - Intronic
1122957542 14:105077853-105077875 TGTGGGCTCCAGCTCTGGCCTGG + Intergenic
1124244806 15:28059751-28059773 TGCGTGTTCCAGCTCTGCCCAGG - Intronic
1124605787 15:31169566-31169588 TCAGGGGCTCAGCTCTGGCCTGG - Intergenic
1124645546 15:31435456-31435478 CTAGGGTCCAAGCTCTTTCCTGG + Intronic
1125070271 15:35546118-35546140 TGAGGGTCGCGGCTCTGATCAGG - Exonic
1125744975 15:41991824-41991846 AGAGCTTCCCACCTCTGTCCAGG - Intronic
1126634223 15:50765756-50765778 GGAGAGTCCCAGCGCTCTCCCGG + Exonic
1128694506 15:69750575-69750597 TGAGGGCCCCAGCTTTTTGCTGG + Intergenic
1129826454 15:78637958-78637980 GGAGGGACCCAGCTCTAGCCTGG - Intronic
1129902558 15:79162148-79162170 TGAGGGTCCTGGCTCTTTGCTGG - Intergenic
1130241816 15:82200593-82200615 GGAGGCTCCCAGGTATGTCCTGG - Intronic
1130421268 15:83749277-83749299 TGAGGGTCACATCCCTGGCCAGG - Intronic
1130458612 15:84140569-84140591 GGAGGCTCCCAGGTATGTCCTGG + Intergenic
1130934176 15:88454962-88454984 TGAGTGCCCCACATCTGTCCTGG + Intergenic
1132331612 15:101015880-101015902 GGAGGGTGCCAGCACTGTCAGGG + Intronic
1132665166 16:1078221-1078243 TGACGGTCCCTGCGCTGGCCTGG + Intergenic
1132731872 16:1366790-1366812 TGAGGGTCACAGCTGTGAACAGG + Intronic
1132865880 16:2092508-2092530 TGGGGGCCCCAGCTCTGGGCTGG + Exonic
1133491047 16:6268355-6268377 TTAGGGTCTGAGCACTGTCCTGG - Intronic
1133692907 16:8233674-8233696 TGTGGGTATCATCTCTGTCCTGG + Intergenic
1134684632 16:16150120-16150142 TGAGGGTCCTGGCTCAGACCAGG + Exonic
1136710755 16:32234656-32234678 TGAGGCTCCCAGCTCTGCAAGGG + Intergenic
1136757156 16:32694755-32694777 TGAGGCTCCCAGCTCTGCAAGGG - Intergenic
1136764978 16:32769474-32769496 GGAGGGTGCGTGCTCTGTCCTGG - Intergenic
1136810953 16:33175620-33175642 TGAGGCTCCCAGCTCTGCAAGGG + Intergenic
1136817429 16:33285700-33285722 TGAGGCTCCCAGCTCTGCAAGGG + Intronic
1136823993 16:33342229-33342251 TGAGGCTCCCAGCTCTGCAAGGG + Intergenic
1137001380 16:35233507-35233529 TGAGACTCCCAGCTCTGTAAGGG - Intergenic
1137003376 16:35250941-35250963 TGAGGCTCCCAGCTCTGCAAGGG - Intergenic
1138270028 16:55689379-55689401 TCAGGGTCTCAGCTCAGTCATGG + Intronic
1138482542 16:57313155-57313177 GGAGGGGCCCAGCTTTGGCCGGG + Intergenic
1138574916 16:57901422-57901444 TGCCGGTCACAGCCCTGTCCCGG + Exonic
1140977264 16:80072036-80072058 ATAGAGTCCCAGCTCTGCCCTGG - Intergenic
1141431631 16:83973248-83973270 TGAGGGTGGCAGCTCTGGCCTGG + Intronic
1141767845 16:86070462-86070484 TGAGCCTCCGAGCGCTGTCCTGG - Intergenic
1142178654 16:88656675-88656697 TGTGGAGTCCAGCTCTGTCCTGG - Intronic
1203059305 16_KI270728v1_random:955106-955128 TGAGGCTCCCAGCTCTGCAAGGG - Intergenic
1143118978 17:4595712-4595734 TGGGGCTCCCAGCTCTGGCCAGG - Intronic
1143462813 17:7114772-7114794 TGAGTGTCCAAGCTCTAACCTGG + Intronic
1143646334 17:8232566-8232588 TGAGGGCAGCAGCTCTGGCCTGG - Intronic
1144177085 17:12717897-12717919 TTAGGGTGCCACCTCTGTGCTGG + Intronic
1144339155 17:14298316-14298338 TTTGGCTACCAGCTCTGTCCAGG + Intergenic
1144661883 17:17076251-17076273 TGATGGTCCCAGCTCTAGCGGGG - Intronic
1144676241 17:17164035-17164057 TGAGTGTCACACCTCTGGCCAGG - Intronic
1145888093 17:28396550-28396572 GGAGGGTCCCTGCTCAGTTCTGG + Exonic
1146051223 17:29555089-29555111 TGAGGGTGTTAGCTCTGTGCAGG + Intergenic
1146541538 17:33700151-33700173 TGAGGATCCCAGCTTAGTCTGGG - Intronic
1146559729 17:33857714-33857736 TTTGAATCCCAGCTCTGTCCTGG - Intronic
1147212471 17:38879929-38879951 GAAGGGTTGCAGCTCTGTCCTGG + Intronic
1147357397 17:39908773-39908795 TGAGGCTCCATGCTCTGACCTGG - Intronic
1147403398 17:40194194-40194216 TGGGGGTCCCAGCCCTGACCAGG - Exonic
1149213190 17:54326794-54326816 GGAAGGCCCCAGCTCTGTCAAGG + Intergenic
1149506761 17:57200821-57200843 TGAGTGTCCCATCTCAGTCACGG + Intergenic
1149685498 17:58532241-58532263 TGAGGCTCCCCGCTCTGTCCTGG - Intronic
1152073776 17:78146735-78146757 TGATGGTGCCAGCTGAGTCCTGG + Intronic
1152087115 17:78227085-78227107 TGCAGGTCTCAGCTTTGTCCGGG + Intergenic
1152125632 17:78444979-78445001 GGAGGCTCCCGGCGCTGTCCTGG - Intronic
1152426817 17:80222549-80222571 TGTGGGTGTCAGCTGTGTCCAGG - Intronic
1152527952 17:80900255-80900277 TGGTGGTCGCAGCTCTCTCCCGG + Intronic
1153582058 18:6583139-6583161 AGAGGGTCACGGCTCTGTACAGG - Intronic
1154176195 18:12088238-12088260 TGATGGTCCTGGCTCTGCCCTGG + Intergenic
1157797239 18:50586085-50586107 TGAGGATACCTGCTCTGTACAGG + Intronic
1160015916 18:75140540-75140562 TGAGGGTCTCAGCCCAGTGCAGG - Intergenic
1160212543 18:76894736-76894758 AGAGGGAGCCAGCTGTGTCCTGG + Intronic
1160392847 18:78548040-78548062 CGGGGGCCCCAGCTCTGCCCAGG + Intergenic
1160538641 18:79608777-79608799 TGAGGCCACCAGCTCCGTCCCGG + Intergenic
1161588247 19:5117197-5117219 AGAGGGCCCCAGAACTGTCCTGG - Intronic
1161979532 19:7623476-7623498 GGAGGGTCACAGCTCTCTCCTGG - Intronic
1161984093 19:7644458-7644480 TCAAGGTCCCACCCCTGTCCAGG - Intronic
1162749154 19:12817809-12817831 TGGGGGACCCAGCTCTGATCTGG + Intronic
1163677709 19:18663579-18663601 TGAGGCACCCTGCTCTGTCCTGG - Intronic
1164578186 19:29418319-29418341 GCAGGGCCCCAGCTCTGGCCAGG + Intergenic
1166504961 19:43365282-43365304 TGAGTCTCCCAGCACTGGCCTGG - Intergenic
1166505578 19:43369632-43369654 TGAGTCTCCCAGCACTGGCCTGG + Intergenic
1166840278 19:45692928-45692950 TGAGGGTCCCCGCGGTGCCCGGG - Intronic
1167049597 19:47070349-47070371 AGTGGGTCCCAGCTCTGCGCTGG - Intronic
1168126589 19:54286727-54286749 CGGGGGTTCCAGCTCTGCCCAGG + Intergenic
1168175301 19:54624136-54624158 CGGGGGTTCCAGCTCTGCCCAGG - Intronic
925159606 2:1674891-1674913 TGAGCGACCCAGCTTGGTCCAGG - Intronic
925270811 2:2606153-2606175 GGAGGCTCCCACCTCCGTCCTGG - Intergenic
925855717 2:8127232-8127254 TGAAGATCCCAGTTCTGTCTGGG - Intergenic
927268421 2:21179667-21179689 TGAGGACCACAGCTCTGACCTGG + Intergenic
927937841 2:27085596-27085618 AGAGGGTCCCTCCTCAGTCCAGG + Intronic
928116449 2:28548491-28548513 TTGGAGTCCCAGCTCTGTCCTGG + Intronic
929247719 2:39720755-39720777 TAAGGGAGTCAGCTCTGTCCAGG - Intergenic
930259271 2:49126225-49126247 TGAGGGTCCCATGTCTGTCAAGG + Intronic
932775689 2:74527041-74527063 TCAGTTTCCCAGCTCTGGCCCGG - Exonic
932892985 2:75612014-75612036 GCAGGGTCCCAACTCTGTGCAGG - Intergenic
934087033 2:88518280-88518302 TTTGGGGCCCAGCTCTCTCCAGG + Intergenic
936462333 2:112722637-112722659 TGAGGGTCCCAGCTCTGTCCTGG + Intronic
938663784 2:133513061-133513083 TGAGTGTGCCATCTCTTTCCTGG - Intronic
939974774 2:148704840-148704862 ATAGGCTCCCAGCTATGTCCTGG + Intronic
948686625 2:239674492-239674514 TGGGGGTCCCATCTCTGGGCTGG + Intergenic
1168911271 20:1449089-1449111 GGAGGGACCCAGCTCTGCACTGG + Intronic
1169142231 20:3233173-3233195 TGAGGGTCCCTGCTCCTTCCTGG - Intronic
1169179706 20:3552745-3552767 CGAGGGTCCCAGCTTTCTGCTGG + Intronic
1172483918 20:35287387-35287409 GGGGTGCCCCAGCTCTGTCCCGG - Exonic
1173701422 20:45075191-45075213 TGAGGGCCCCAGCTCCACCCAGG + Exonic
1175999611 20:62826013-62826035 TGGGGGTCCCACCTCTGCCAAGG + Intronic
1179566403 21:42251747-42251769 TGAGTCTCCCAGCTCTCTCTGGG - Intronic
1179947610 21:44688758-44688780 GGTGGGTCCCACCTCTGCCCTGG - Intronic
1180089242 21:45525313-45525335 TGAGGGTCCCAGCCAAGGCCGGG - Intronic
1182331727 22:29555754-29555776 TGAGGATTACAGCTCTGCCCAGG - Exonic
1183317383 22:37144149-37144171 TGGCGGCCCCTGCTCTGTCCTGG - Exonic
1183684465 22:39353565-39353587 TGAAGGTCACAGCTGTGGCCTGG - Intronic
1183729807 22:39611785-39611807 TGAGGTTCCCAGAGCTGCCCTGG + Intronic
1183952548 22:41359692-41359714 TGGGGGCTCCAGCTCTGGCCAGG - Exonic
1184419112 22:44369324-44369346 TGAGCGTCCCAACTTTGCCCGGG - Intergenic
1185338042 22:50279543-50279565 TGTGGGTCCCATCTGTGGCCAGG + Intronic
1185344718 22:50306239-50306261 TGGGGGGCCCACCTCTGTCCCGG - Intronic
1185415773 22:50709372-50709394 TGAGGGTCCAAGGTCAGTCACGG + Intergenic
951440508 3:22717747-22717769 TGAATTTCCCAGCTATGTCCAGG + Intergenic
953044264 3:39281121-39281143 TGCAGCCCCCAGCTCTGTCCTGG - Intronic
953412421 3:42697853-42697875 TGGGAGACCCAGTTCTGTCCTGG + Intronic
953926712 3:46986290-46986312 TGAGGGACCCACCCCTGTGCTGG + Intronic
954711152 3:52505688-52505710 TGAAGGGCCCAGGTCCGTCCAGG - Exonic
960556332 3:119034710-119034732 TGACAGTCCCAGCTCTGCGCGGG - Exonic
961202411 3:125055603-125055625 GGAGGGTCCCCGCTGTGTCGCGG + Exonic
962853033 3:139322200-139322222 TGAAGGTCACAGCTCCCTCCAGG + Intronic
964902053 3:161671373-161671395 AGTGGGTCCCAACTCTGCCCGGG + Intergenic
965665871 3:171092829-171092851 AGAGTTTCCCAACTCTGTCCTGG + Intronic
966149052 3:176846262-176846284 TCAGGGCCCCAGTTCTCTCCAGG + Intergenic
966914557 3:184577627-184577649 TGAGGGTGCCCCCTCTCTCCTGG + Intronic
968601776 4:1513054-1513076 GGAGGGTCCCAGCACCGCCCAGG + Intergenic
968601784 4:1513075-1513097 GGAGGGTCCCAGCACCGCCCAGG + Intergenic
969673895 4:8604285-8604307 TGAGGCCCCCAGCTCTGCCCAGG - Intronic
969718151 4:8878265-8878287 TTTGGGTCCCAGCTCTGCCATGG + Intergenic
972360243 4:38319941-38319963 TGAACGCCCCAGCTCGGTCCTGG - Intergenic
973178132 4:47233388-47233410 TGAGGGTCCAAGCTCTTTCTAGG + Intronic
976123124 4:81804668-81804690 TGAGTGTCCCAGGTCTCACCGGG - Intronic
977030248 4:91874271-91874293 TGACAGTGACAGCTCTGTCCAGG + Intergenic
977870025 4:102080511-102080533 TGAGGGTTCCAGGTTTTTCCTGG + Intergenic
977978415 4:103294347-103294369 TGAGTGTGCCATCTCTTTCCTGG - Intergenic
980088299 4:128415504-128415526 TAAGGGTCCTAGCTCTGCACAGG + Intergenic
983178295 4:164617268-164617290 TGAGAGTCCCAGCTTTTTACTGG + Intergenic
985780506 5:1868474-1868496 TCAGGGCCTCAGCTCTTTCCTGG + Intergenic
986151157 5:5131462-5131484 AGGGGGTGCCAGCTCTGTCCTGG + Intergenic
986220337 5:5763341-5763363 TGAGGATCCCACCTCTTGCCAGG + Intergenic
988254933 5:28809235-28809257 TGAGGGCCTTAGCTCTGGCCAGG - Intergenic
989635738 5:43530960-43530982 TGAGGGTCCCAGGTTTGTGCAGG - Intronic
992600633 5:78395664-78395686 TGAGGGTCCTAGCTTTTTGCTGG + Intronic
994053982 5:95394695-95394717 GGAGGGTACAAGCTCTCTCCTGG + Intronic
994841336 5:104928949-104928971 TGAGGGAGCCGGCTCTGGCCTGG - Intergenic
995451768 5:112309911-112309933 TGAGGTTCCCATCTCTTTGCTGG - Intronic
996459121 5:123720834-123720856 TAAGGCTCCTAGCTCTATCCTGG + Intergenic
997589094 5:135062127-135062149 AGAGATTCCCTGCTCTGTCCTGG - Intronic
997638755 5:135434903-135434925 CGAGGGTCTGGGCTCTGTCCTGG - Intergenic
999630815 5:153569453-153569475 TGTGGGACCAAGCTCTGTTCCGG + Intronic
1001403964 5:171462623-171462645 TGAGGTTTCCAGCTCTGGCAAGG + Intergenic
1001588499 5:172849731-172849753 TGTGGGTCTCCTCTCTGTCCTGG + Intronic
1002060386 5:176622119-176622141 TGGGTGTCCCAGCTCCATCCAGG + Intronic
1002298762 5:178246106-178246128 TGTGGATGCCAGGTCTGTCCTGG - Intronic
1002692997 5:181063891-181063913 TCAGGGTCCCAGCACGGTCAGGG + Intergenic
1004045402 6:12018289-12018311 TGAGGGAGCCGGCTCTGGCCTGG + Intronic
1006730583 6:36233244-36233266 AGAAGGTGCCAGCGCTGTCCGGG - Intergenic
1006730703 6:36234106-36234128 TGAGGGTCCCAGATATGTGGAGG + Intergenic
1007630439 6:43270215-43270237 TGAGCGCCCCTGCCCTGTCCTGG - Intronic
1007837112 6:44682321-44682343 TGAGGTTCCCAGACCTTTCCAGG + Intergenic
1010441265 6:75897513-75897535 TCAGGGTCCCAGCTCTTGGCAGG + Intronic
1011901434 6:92302753-92302775 TGAGAGACCCAGCTCTGTGATGG + Intergenic
1013274052 6:108567379-108567401 TGGGGATCCCAGATCAGTCCAGG - Intronic
1014738945 6:125125811-125125833 TGAGGGAGCCAGCTCTGGCCTGG - Intronic
1018167926 6:161116726-161116748 TGATGCTCCCAGCACTGTACTGG - Intronic
1018397245 6:163387947-163387969 TGAGGGGCCCAGCTCCCTTCCGG + Intergenic
1018799696 6:167212391-167212413 TGAGGGTTTCACCTCTGTCTGGG - Intergenic
1018813270 6:167313102-167313124 TGAGGGTGTCACCTCTGTCTGGG + Intronic
1019060121 6:169251566-169251588 TGAGGGTCCCAGGGCTCCCCAGG + Intronic
1019216595 6:170447818-170447840 AGAGGGTGACAGCACTGTCCCGG + Intergenic
1019633914 7:2065318-2065340 TGAGGGTGGCAGCCGTGTCCAGG + Intronic
1020179882 7:5913962-5913984 TGAAGGTCTCAGTTCTGTCTGGG - Intronic
1023038814 7:36154702-36154724 TGAGGGGCACAGCTGTGGCCAGG - Exonic
1023962237 7:44936482-44936504 TCAGGGTCACAGCACTGTCATGG + Intergenic
1024579284 7:50788734-50788756 TGTGGCTCCGAGCTCTATCCAGG - Intronic
1025109087 7:56197727-56197749 TAAGGGTCCCCACTCTGCCCAGG + Intergenic
1026308640 7:69165258-69165280 TGAGGGTCCCCACTCTGCCCAGG - Intergenic
1026870692 7:73849453-73849475 AGAGGCCCCCGGCTCTGTCCTGG + Intergenic
1026959850 7:74401069-74401091 AGAGGGAGGCAGCTCTGTCCCGG + Intronic
1027173293 7:75888017-75888039 TGAGGGTGGCAGCTCTGTGTGGG - Exonic
1027185402 7:75968023-75968045 GGAGGGTCACAGCTCTCTCCTGG - Intronic
1028034146 7:85958709-85958731 TGAGGGTTCCAGCTTTTTGCTGG + Intergenic
1029034596 7:97505698-97505720 TGAGTGTCCCTGCTGTTTCCTGG + Intergenic
1029676304 7:102071450-102071472 TGTGGGGCCCAGCTCAGCCCTGG + Intronic
1031083270 7:117278470-117278492 AGAGGGTCAGGGCTCTGTCCTGG - Intronic
1031549185 7:123087227-123087249 TGATGTTCCCCTCTCTGTCCAGG - Intergenic
1034447505 7:151121103-151121125 TGGAAGTGCCAGCTCTGTCCGGG - Intronic
1035739560 8:1915956-1915978 TCAGGGTCACGGCCCTGTCCAGG + Intronic
1039443336 8:37610952-37610974 TGAGGGTCACAGATGTGTCGTGG - Intergenic
1040305655 8:46210498-46210520 AGAGGGCCCCAGCGCCGTCCCGG + Intergenic
1040307252 8:46218519-46218541 TGAAGTTCCCAAGTCTGTCCTGG - Intergenic
1040331631 8:46388623-46388645 AGAGGCTCTCAGGTCTGTCCCGG + Intergenic
1040726659 8:50388928-50388950 TGATTGTGGCAGCTCTGTCCTGG + Intronic
1041134155 8:54737810-54737832 TGACTGTCCCAGCTCTTTCAGGG + Intergenic
1044819067 8:96143862-96143884 TGAGTTTACCAGCTCTGCCCTGG - Exonic
1045494282 8:102695298-102695320 TGATGGGCCCAGCTGTGTCGAGG + Intergenic
1046239027 8:111466201-111466223 TCAGGGTGCCAGCACTGTCGAGG + Intergenic
1046586401 8:116153951-116153973 TGAGGGTCCCAATTCCTTCCTGG - Intergenic
1046937944 8:119903746-119903768 TGAGGCTTACAGCTCCGTCCTGG + Intronic
1049258774 8:141627723-141627745 TGATGGTCCATGCTCTGCCCTGG - Intergenic
1049418505 8:142506315-142506337 TGAGGGTCCCAGGTCGCTCTAGG + Intronic
1051896643 9:21995179-21995201 CGGGGGTCCCAGCTGGGTCCGGG + Intronic
1053412110 9:37922639-37922661 TGCTGGTCCCAGCTCTGCCTTGG - Intronic
1057181683 9:93034050-93034072 TGAGGGGTCCAGCTCTGGCAGGG + Intronic
1057225646 9:93291747-93291769 TGAGGGTCTCAGCTCAGGCGAGG + Intronic
1060048436 9:120359287-120359309 TCATGTTCCAAGCTCTGTCCAGG + Intergenic
1060053161 9:120391396-120391418 TGTGAGTCCCAGCTCTGTGCTGG - Intronic
1060412269 9:123407669-123407691 TGAGGATCCCAGCCGCGTCCGGG + Intronic
1060518534 9:124280715-124280737 TGAGGACCCCAGCTCTCTGCAGG - Intronic
1061297235 9:129683363-129683385 TGAGAGCCCCTGCTCTGTGCAGG + Intronic
1061908379 9:133710393-133710415 TGAGGGTCCCAGGGCTGACCGGG - Intronic
1062279290 9:135744799-135744821 TGAGGCTCCCTGCTGTGTCTGGG + Intronic
1188274238 X:28180148-28180170 TGAGGGCCCCAGCTTTTTGCTGG - Intergenic
1188445263 X:30248213-30248235 TGAGCCTGCCAGCTCTGGCCTGG - Intronic
1189561541 X:42195997-42196019 TGAGGGTCCAACCTCTGCCACGG - Intergenic
1194655688 X:96570531-96570553 TGGGCATCCCAGCACTGTCCAGG + Intergenic
1195695172 X:107661550-107661572 TGAAAATCCCAGCTCTGTACTGG - Intergenic
1196458093 X:115903879-115903901 TGTGGGGCCCTGCCCTGTCCTGG + Intergenic
1196483901 X:116181890-116181912 TGGGGCTCCCTGCCCTGTCCTGG - Intergenic
1200207414 X:154327127-154327149 TGTGGGTCCCAGCCCTGCCCTGG + Intronic