ID: 936462831

View in Genome Browser
Species Human (GRCh38)
Location 2:112724782-112724804
Sequence CTGAAGCCTCGGGCAGGCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 296}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936462822_936462831 -2 Left 936462822 2:112724761-112724783 CCCGTGTGCACCCCCAACAGGCT 0: 1
1: 0
2: 0
3: 7
4: 173
Right 936462831 2:112724782-112724804 CTGAAGCCTCGGGCAGGCCCTGG 0: 1
1: 0
2: 1
3: 30
4: 296
936462820_936462831 17 Left 936462820 2:112724742-112724764 CCAGGCTGTGTGTGTGCAGCCCG 0: 1
1: 0
2: 1
3: 23
4: 231
Right 936462831 2:112724782-112724804 CTGAAGCCTCGGGCAGGCCCTGG 0: 1
1: 0
2: 1
3: 30
4: 296
936462823_936462831 -3 Left 936462823 2:112724762-112724784 CCGTGTGCACCCCCAACAGGCTG 0: 1
1: 0
2: 0
3: 19
4: 218
Right 936462831 2:112724782-112724804 CTGAAGCCTCGGGCAGGCCCTGG 0: 1
1: 0
2: 1
3: 30
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936462831 Original CRISPR CTGAAGCCTCGGGCAGGCCC TGG Exonic
900353324 1:2247717-2247739 CTGATGCCAGGAGCAGGCCCTGG - Intronic
900435432 1:2628728-2628750 CTGGAACCTCGGGCTGTCCCGGG - Intronic
900490636 1:2947195-2947217 CTGGAGCAGCGGCCAGGCCCTGG - Intergenic
900530280 1:3149639-3149661 GTGAAGCCTCAGGCAGCCCCTGG + Intronic
900611744 1:3547179-3547201 CTGAGGCCTCGGGTGGGCCGAGG - Intronic
901402097 1:9021634-9021656 CTGAAGGCTGTGGCAGCCCCAGG - Intronic
901771666 1:11533632-11533654 CTGAAGCCCCAGGCAGTTCCAGG + Intronic
901810728 1:11765681-11765703 GTGAAGCCATGGGCAGCCCCGGG - Intronic
902569544 1:17338378-17338400 CTGATGCCTCCTACAGGCCCTGG + Intronic
902615951 1:17623632-17623654 CTGCAACCTAGGGCAGGTCCAGG + Intronic
902942612 1:19811525-19811547 CTGAATCCTCACGGAGGCCCTGG + Intergenic
903666219 1:25009188-25009210 CTGAAGCCTCGGGAGGCCTCTGG + Intergenic
904848225 1:33436950-33436972 CTGAAAACTGGGGCAGGCCAGGG + Intergenic
905920410 1:41715370-41715392 CTGAAGACTCAGGCTGGACCTGG - Intronic
911840546 1:102676020-102676042 CTGAAGCCTCTGACATGTCCTGG + Intergenic
913088209 1:115458317-115458339 CTGAAGCCCAGGGCACGTCCAGG + Intergenic
914917515 1:151827706-151827728 CTGAAGCCCCAGGAAGGCCCAGG - Intronic
915706809 1:157851679-157851701 CTGCAGCCTCAGGAAGGCCTAGG - Intronic
919917750 1:202149312-202149334 CTGAAGCCTTGGGTCGGGCCAGG + Intronic
920308383 1:205033168-205033190 CTAAAGCTTAGGGCAGGGCCAGG - Intergenic
920312554 1:205057154-205057176 CTGAATCCTCATGCAGACCCTGG + Intronic
920803161 1:209208093-209208115 CTGCAGCCGCGGGAAAGCCCGGG - Intergenic
922749958 1:228065672-228065694 CTGAAACATCGGGGAGGGCCAGG - Intergenic
922774717 1:228209313-228209335 CTGTCGCCTGGTGCAGGCCCAGG - Intronic
922822460 1:228493719-228493741 CGGAAGTCTGGGCCAGGCCCTGG + Intronic
924631229 1:245742809-245742831 CAGAAGCCTCAGGAAGCCCCTGG - Intergenic
1067087574 10:43250955-43250977 CTGGAGCCTCTGCCTGGCCCTGG - Intronic
1067308842 10:45093287-45093309 CTGCAGCCTCGGGGGGGCCCAGG + Intergenic
1067436564 10:46282989-46283011 CTGATGGCTCGGGCTGGGCCGGG - Intergenic
1068777274 10:60881526-60881548 CAAGAGCCTGGGGCAGGCCCAGG + Intronic
1070767618 10:79065864-79065886 CTGGAGCCTAGGGAAGACCCAGG + Intergenic
1070788070 10:79173881-79173903 CTGAACCCTCAGCCAGACCCTGG + Intronic
1071439233 10:85675934-85675956 CTGAAGATTCAGTCAGGCCCTGG + Intronic
1076262257 10:129076267-129076289 CTGATGCCTTGGGCAGACGCTGG + Intergenic
1076482208 10:130792175-130792197 CTGAGGCCTGGGGCCAGCCCAGG - Intergenic
1076514224 10:131034020-131034042 CTGGAGCCTCCTGCAGGGCCTGG - Intergenic
1076909316 10:133379328-133379350 CGGCAGCGTCGGGGAGGCCCCGG + Exonic
1077103530 11:832483-832505 CTGGAGACCCGGGCAGGCCTGGG - Intergenic
1077235659 11:1480932-1480954 CTGACCCCCCGGGCAGACCCTGG - Intronic
1077282303 11:1751224-1751246 CTGAGGCCGGGAGCAGGCCCTGG - Intronic
1077525270 11:3060482-3060504 CTGATGCCTTGGTCTGGCCCTGG + Intergenic
1078222564 11:9364086-9364108 CTGAGGCCTCGGACAGCCGCGGG - Intergenic
1078356458 11:10635537-10635559 CTGGAGCCTCTGGCAGAGCCAGG + Intronic
1078428362 11:11269065-11269087 CTGTAGTCTCAGACAGGCCCTGG - Intergenic
1078580576 11:12536636-12536658 CTGAACCCACTGGCTGGCCCTGG + Intergenic
1079993857 11:27274681-27274703 GTCAATCCTAGGGCAGGCCCTGG - Intergenic
1081811004 11:45914103-45914125 GTGAAGCCCCAGGCAGGCCCAGG + Intronic
1082278485 11:50246330-50246352 CTGCAGGCTGGGACAGGCCCTGG - Intergenic
1083364153 11:62131227-62131249 CTGCAGCCTGGGGCAGGTCCTGG + Intronic
1083821394 11:65173188-65173210 CCAAAGCCTCCGGCACGCCCTGG + Exonic
1083842032 11:65310083-65310105 CTGATGCCTCAGCCAGGGCCTGG - Intergenic
1083891869 11:65599597-65599619 CTGCAGCCGCCGGGAGGCCCAGG - Exonic
1083903425 11:65654860-65654882 CTGGAGCCTGGGGCAGGACTTGG + Exonic
1085846985 11:80077296-80077318 ATGCAGCCTGGGGCAGGTCCAGG + Intergenic
1088322826 11:108570995-108571017 CTTAAGGCTCTGGAAGGCCCAGG + Intronic
1088729475 11:112668199-112668221 CTGAAGCCTCATGTAGGCACTGG - Intergenic
1089462854 11:118662848-118662870 GTCAGGCCTTGGGCAGGCCCAGG + Intronic
1096233558 12:49910781-49910803 CCGAAGCCTCGGGCAGGCATCGG + Intergenic
1100660985 12:96698664-96698686 CTGCACCCTCAAGCAGGCCCTGG - Intronic
1101967807 12:109293006-109293028 CTGCAGCCCCCCGCAGGCCCAGG + Intronic
1102460489 12:113096906-113096928 CTGCAGCCTCGGATACGCCCTGG - Exonic
1103010786 12:117456699-117456721 CTGGAGCTTCCGGCAGTCCCAGG - Exonic
1103921517 12:124401885-124401907 CTGCAGCCCCTGGCAGGCACAGG + Intronic
1103985878 12:124767186-124767208 GTGCAGCCTCTGGCAGGCCCTGG + Intergenic
1107873027 13:44764442-44764464 ATGAAGCCTCGTGCAGTTCCAGG + Intergenic
1111125193 13:83906161-83906183 CGGAAGCCTGGGCGAGGCCCTGG - Intergenic
1113560225 13:111272805-111272827 CTGAGGTCTCTGTCAGGCCCTGG - Intronic
1113710170 13:112457829-112457851 TTGAAGCCTGAGTCAGGCCCAGG - Intergenic
1113838873 13:113347374-113347396 CTGAAGCCGAGAGCAGACCCGGG + Intronic
1113838960 13:113347760-113347782 CTGAAGCCGAGAGCAGACCCGGG + Intronic
1113838987 13:113347878-113347900 CTGAAGCCGAGAGCAGACCCGGG + Intronic
1115752435 14:36505915-36505937 CTGAGCCCCCGGGCAAGCCCAGG + Intronic
1116680860 14:47968311-47968333 CTGAAACCCCCGACAGGCCCCGG + Intergenic
1117913748 14:60656887-60656909 ATCAACCCTCGTGCAGGCCCGGG + Intronic
1119071440 14:71588825-71588847 CAGAAGACTCTGTCAGGCCCTGG + Exonic
1119328210 14:73774836-73774858 AGGGAGCATCGGGCAGGCCCAGG - Intronic
1121456768 14:94043389-94043411 CTGGAGCCAGGGCCAGGCCCAGG + Intronic
1122417576 14:101557788-101557810 CTGAGGCTTCGGGCAGGAGCTGG - Intergenic
1122838623 14:104443571-104443593 CTGCAGCCTCGAGCAGGGCCAGG - Intergenic
1122921605 14:104882624-104882646 CTGGACTCTGGGGCAGGCCCTGG - Intronic
1123058538 14:105583986-105584008 CTGAGGACACGCGCAGGCCCAGG - Intergenic
1123082871 14:105704219-105704241 CTGAGGACACGCGCAGGCCCAGG - Intergenic
1123630075 15:22255060-22255082 TTGCAGCCTCTGGTAGGCCCAGG + Intergenic
1124057796 15:26258616-26258638 GTGAAGCATCGGGCAAGCTCTGG - Intergenic
1124497667 15:30196245-30196267 CCCAAGCCTCGCGCAGTCCCGGG - Intergenic
1124745919 15:32342446-32342468 CCCAAGCCTCGCGCAGTCCCGGG + Intergenic
1124973664 15:34514506-34514528 CCCAAGCCTCCGGCAGTCCCGGG + Intergenic
1125577157 15:40763910-40763932 CGGAAGCCTCAGGTGGGCCCCGG + Intergenic
1126100299 15:45114645-45114667 CTGAAGCCTGCGGCATGCCGGGG - Exonic
1126467917 15:48977255-48977277 CTCCACCCTCAGGCAGGCCCTGG + Intergenic
1127902539 15:63351543-63351565 CTGAAGCATGGGGCAGGCTGGGG - Intronic
1128269177 15:66293725-66293747 CTGCAGCCACGGTCAGGGCCGGG + Exonic
1132113573 15:99119599-99119621 CTGTGACCTCGGACAGGCCCAGG - Intronic
1132186700 15:99806982-99807004 CCCAAGCCTCGCGCAGTCCCGGG - Intergenic
1132428987 15:101745729-101745751 CCCAAGCCTCGCGCAGTCCCGGG + Intergenic
1132557568 16:579290-579312 CTGAGGCCGCGCACAGGCCCTGG + Intronic
1132974301 16:2703774-2703796 GTGTAGGCTGGGGCAGGCCCTGG + Intronic
1133258550 16:4533775-4533797 CAGAATCCTCAGGAAGGCCCAGG - Intronic
1134223536 16:12374215-12374237 CTGATGCCTAGGTCAGTCCCTGG - Intronic
1134623590 16:15708188-15708210 CTCAAGCCACGTGCAGCCCCCGG + Intronic
1135423929 16:22323007-22323029 CTGGAGCCTCTGCCGGGCCCCGG - Intronic
1135551834 16:23404559-23404581 CTGAAGCCTCAGACATGTCCAGG + Intronic
1136114695 16:28087363-28087385 CTGTTGCCTGGGGCAGGCCTGGG - Intergenic
1136541477 16:30929904-30929926 CTAAAGCCACTGCCAGGCCCTGG - Intronic
1136996862 16:35196457-35196479 CTGAAGCCGCGCGGAGGCCCAGG + Intergenic
1138473575 16:57257514-57257536 CTGGAGCCACGGCCAAGCCCAGG - Intronic
1139421878 16:66854019-66854041 CTGCTGCCACGGGCAGGCCCTGG + Exonic
1139462265 16:67132048-67132070 CTGATTCCTGGGGCAGGCTCAGG + Intronic
1139469268 16:67169695-67169717 TTAAAGCCCCAGGCAGGCCCAGG - Exonic
1139663631 16:68439809-68439831 CTGACTCCTAGGGCAGGCCATGG - Intronic
1141495419 16:84406441-84406463 TTGAAGCCTGGGGCAGCCCAGGG - Intronic
1141714098 16:85716995-85717017 CTGAAGCCTTGGGACGGGCCTGG - Intronic
1141973016 16:87495597-87495619 TTGCAGCCTCTGGTAGGCCCAGG - Intergenic
1142155982 16:88533099-88533121 CTCAGGCCTGGGGCAGGACCTGG - Intronic
1142519399 17:494325-494347 GAGAAGCCTCGGCCAGGCCACGG - Intergenic
1142594687 17:1023698-1023720 CTGAAGCCTCGAGCTGGACCTGG + Intronic
1143165171 17:4893939-4893961 CTGTGGCCACGGGCAGGACCTGG + Intronic
1143390289 17:6556059-6556081 CGGAGGCCCCGGGCAGACCCGGG - Intronic
1143727721 17:8860822-8860844 CTGAAGCCGGGGGCAGTGCCAGG + Intronic
1144626166 17:16845418-16845440 CTGTAGTCACGGGCGGGCCCCGG + Intergenic
1144782056 17:17813379-17813401 CTGAGGCGGCGGGCAGGCCCCGG - Exonic
1144833360 17:18143865-18143887 CACAGGCCTCGGGCTGGCCCAGG + Exonic
1144880267 17:18427302-18427324 CTGTAGTCACGGGCGGGCCCCGG - Intergenic
1145151966 17:20517085-20517107 CTGTAGTCACGGGCGGGCCCCGG + Intergenic
1146163336 17:30571356-30571378 CTGTAGTCACGGGCGGGCCCCGG + Intergenic
1147580309 17:41624115-41624137 CTGTAGTCACGGGCGGGCCCCGG + Exonic
1147764438 17:42824203-42824225 CTGTGGCCTCGGGTCGGCCCCGG + Exonic
1147964742 17:44188343-44188365 CTGAAACTTCTGGCAAGCCCTGG - Intronic
1148103822 17:45108714-45108736 CTGAAGCCTCAGGCCTCCCCTGG - Exonic
1148899618 17:50866196-50866218 CAGAGGCCTCGGGCAGGCCTTGG + Exonic
1149595415 17:57862107-57862129 CCGAAGCCTCGTGCCTGCCCAGG + Exonic
1150236018 17:63593234-63593256 GTGAACCCTGGGCCAGGCCCTGG + Exonic
1151349053 17:73520734-73520756 CAGAAGCTTCAGGCAGGGCCTGG + Intronic
1151780140 17:76240252-76240274 CTGCAGCCCCGGCCCGGCCCCGG + Exonic
1152321286 17:79609997-79610019 CTGAAGCCTCGGCCACCCCCAGG - Intergenic
1152697544 17:81804448-81804470 CTGCACCGTCGGGCAGGTCCAGG + Intronic
1152838199 17:82549035-82549057 CAGCAGCCTCTGGCAGGACCTGG + Intronic
1153202066 18:2656425-2656447 CGGACGCCTCGGGCGGGCCCTGG + Intronic
1153956882 18:10104002-10104024 CTGAAGCCGCAGGCAGCCACAGG + Intergenic
1157283368 18:46360597-46360619 CTGAAGCACCAGGCAGCCCCAGG + Intronic
1158405276 18:57154651-57154673 CAGGAGCCTCGGCCAGGCCCCGG - Intergenic
1160663103 19:310465-310487 CTGGAGCTCCGGGCAGGTCCTGG - Intronic
1160800129 19:963822-963844 CTGCAGCCTCAGGCAGGCAAGGG - Intronic
1161128498 19:2574004-2574026 CTGCCGCCTCGGGGAGGCCTGGG + Intronic
1161267299 19:3370180-3370202 GTGCCACCTCGGGCAGGCCCTGG - Intronic
1161325987 19:3664542-3664564 CTGAAACCTCGGGCAGAGCCTGG - Intronic
1161345367 19:3766544-3766566 CTCAAGCCTAGAGCAGGGCCTGG - Intronic
1163061344 19:14764403-14764425 CTGGAGTCTGGGGCAGACCCAGG + Intronic
1163362106 19:16853221-16853243 CCCAATCCTGGGGCAGGCCCAGG - Intronic
1164687369 19:30176340-30176362 TTGTAGCCTCGGGCAGTTCCAGG + Intergenic
1165069219 19:33246149-33246171 AGGAAGCCTCTGCCAGGCCCTGG + Intergenic
1165119204 19:33548202-33548224 CCCAAGACTCGGCCAGGCCCTGG - Intergenic
1165750041 19:38253843-38253865 CTGCATCCTCGGCCAGCCCCAGG - Intronic
1166077286 19:40421106-40421128 CAGAAGCCTCGGGGAGGCAGAGG - Intergenic
1167005971 19:46776940-46776962 CTGGAGACTGGGGCAGGGCCAGG - Intronic
1167367835 19:49064241-49064263 CAGAAGTCTTGGGCGGGCCCTGG - Intronic
1167408923 19:49333659-49333681 CTGAGGGCTCAGGCAGGCTCTGG - Intergenic
1167437194 19:49486345-49486367 CTGGAGCCCCGGGCCGGCGCTGG + Intergenic
1167454551 19:49591490-49591512 CCGAAGGCCCGGGAAGGCCCCGG - Intergenic
1167525150 19:49979014-49979036 CTGGAGCCTGGGGCAGGGCTCGG + Intronic
1167557154 19:50203643-50203665 CCGAAGCCTCGGGACGGCCCTGG + Exonic
924968552 2:101193-101215 CGGAGGCCCCTGGCAGGCCCGGG + Intergenic
925354095 2:3224958-3224980 CTCCAGCCTCGTGCTGGCCCCGG - Intronic
925688231 2:6494558-6494580 CTGAAGGCTGGGAGAGGCCCTGG + Intergenic
925738036 2:6981080-6981102 CTGAGGCCTGGGCCTGGCCCTGG + Intronic
925875691 2:8309434-8309456 CTGAAGCCCCGGCCAGGGCCAGG + Intergenic
927917948 2:26948529-26948551 CAGAAGCCTCGCGCAAGCCTCGG - Exonic
929668855 2:43853691-43853713 CTCAAGCCCCGGCCAGGCCAAGG + Intronic
930617198 2:53606022-53606044 CTGAAGCCCCGGGCTGAACCAGG - Intronic
930617605 2:53609796-53609818 CTGAGGCCTCGGGTAGGAGCTGG - Intronic
932573815 2:72951873-72951895 CTGAGGCCTCTGCCAGGCCTGGG + Intronic
934086821 2:88516829-88516851 CTGAAGCCTCCGCCACTCCCTGG - Intergenic
935122861 2:100197716-100197738 CTGGAGCCACAGCCAGGCCCAGG - Intergenic
935781556 2:106513381-106513403 CTGCAGCCTCGTGCCAGCCCCGG + Intergenic
936048251 2:109203114-109203136 CTGAGGACACGGACAGGCCCAGG - Intronic
936462831 2:112724782-112724804 CTGAAGCCTCGGGCAGGCCCTGG + Exonic
937267351 2:120624899-120624921 GGGCAGCCTGGGGCAGGCCCAGG + Intergenic
937903547 2:127040439-127040461 CTGAGGACTCGGGCAGGACATGG + Intergenic
940773984 2:157867582-157867604 CTGAAAACTCTGGCAGCCCCAGG - Intronic
946834639 2:223760929-223760951 CTGTAGCCTCGGGAGGGGCCTGG + Intronic
947877981 2:233480417-233480439 CTGATGCCACGGGCAGGTCCTGG + Intronic
948677262 2:239604093-239604115 CTGCAGCCTGGGGGAAGCCCAGG + Intergenic
948854904 2:240725509-240725531 CTGAGGCCCTGGGAAGGCCCTGG - Intronic
948886659 2:240888255-240888277 CGGGGGCCTTGGGCAGGCCCGGG - Intronic
948942263 2:241202471-241202493 CTGAGGCCCCGGACAGGCCACGG - Intronic
949034744 2:241811281-241811303 CTGAAGCCCAGAGCAGGGCCAGG - Exonic
1170114126 20:12838602-12838624 CTGGAGTCTAGGACAGGCCCAGG - Intergenic
1170317873 20:15062040-15062062 CTGCAGCCTTGGGCTTGCCCTGG + Intronic
1170766214 20:19291755-19291777 CTGAGGTCTCCTGCAGGCCCAGG - Intronic
1170864535 20:20141879-20141901 CTGGAGCCTTCAGCAGGCCCAGG + Intronic
1171154792 20:22862087-22862109 CTGAAGCCTCAGGGATGCGCAGG + Intergenic
1171367647 20:24637067-24637089 CTGCAGCCACGGGCAGGGCCCGG + Intronic
1171371754 20:24666836-24666858 CTGAGGCCTGGGTCAGCCCCAGG + Intergenic
1175900114 20:62356695-62356717 CTGAAGCCTGGAGCCGGCCTGGG - Intronic
1176216679 20:63951395-63951417 CTGTAGCCCCAGGCAGGCCGGGG - Intronic
1176385593 21:6137397-6137419 CAGAAGCCTGGGGGAGACCCAGG - Intergenic
1178367529 21:31999682-31999704 CAGGAGCCGGGGGCAGGCCCAGG + Exonic
1178690597 21:34746654-34746676 CTGTAGACTCTGCCAGGCCCTGG - Intergenic
1179737880 21:43400855-43400877 CAGAAGCCTGGGGGAGACCCAGG + Intergenic
1179997383 21:44980279-44980301 CCTCAGCCCCGGGCAGGCCCAGG + Intergenic
1180064821 21:45406949-45406971 CTTGAGGCTGGGGCAGGCCCGGG - Intronic
1180089295 21:45525595-45525617 CGGGAGCCTCCGTCAGGCCCTGG - Intronic
1180220378 21:46354749-46354771 CTGTGGCCTCCAGCAGGCCCAGG - Intronic
1180717951 22:17884754-17884776 CTGGAGGCTCTGGCAGCCCCAGG - Intronic
1181081592 22:20419272-20419294 CTGCAGACTCAGGGAGGCCCAGG + Intergenic
1181646419 22:24233641-24233663 CTGAGGCCTAGAGCAGGCCAGGG - Intronic
1182417614 22:30231512-30231534 CAGAAGCCTTGGGCAGCCCCTGG - Intergenic
1182427820 22:30284186-30284208 CTGAAGCGAAGGGCTGGCCCGGG + Intergenic
1182547933 22:31086267-31086289 CTTCAGCCTAGGGCAGGCCCTGG + Intronic
1183356832 22:37364241-37364263 TGGAAGCCTCGGGGAGGCCAGGG + Intergenic
1183359963 22:37378421-37378443 CTGGAGCCTTGGGAAAGCCCAGG + Intronic
1183615626 22:38943500-38943522 CTGAGGCCTCGGACAGGGCAGGG - Intergenic
1183680001 22:39322635-39322657 CTGCAGCCTGGTGCAGGACCCGG - Intergenic
1183744115 22:39683717-39683739 CTGAAGGCTGGGGCAGGTCTGGG - Intronic
1184292023 22:43502471-43502493 CTGAAGCCTGAGGCAGGGCAGGG + Intronic
1184380803 22:44143818-44143840 CTCCAGCCCAGGGCAGGCCCAGG - Intronic
1184776755 22:46627244-46627266 CGGAAGCCTCGGCCTGGCCCTGG + Intronic
1184822626 22:46921243-46921265 CTCCACCCTCAGGCAGGCCCTGG + Intronic
1184978570 22:48080442-48080464 CCGAAGCCTCCACCAGGCCCAGG + Intergenic
950422560 3:12907446-12907468 CTGCAGCCCCAGGCAGTCCCCGG + Intronic
950471799 3:13190941-13190963 CTGTACCCTAGTGCAGGCCCAGG + Intergenic
950583915 3:13879855-13879877 CTGATCCCGCGGGCCGGCCCCGG + Exonic
953033399 3:39192085-39192107 GGGAAGCTTCAGGCAGGCCCAGG - Intronic
953226999 3:41030210-41030232 CTGATCCCTCGGGGAAGCCCTGG + Intergenic
953412972 3:42700724-42700746 GTGAAGCCTCAAGGAGGCCCCGG + Exonic
953917175 3:46927509-46927531 CTGAAGCCTCGGGCAGTGGGTGG - Intronic
954365788 3:50145340-50145362 GTGAAGCCTCAGGCAGTCCAGGG + Intergenic
960937604 3:122913114-122913136 CGGGAGCCCCGGGGAGGCCCAGG - Intronic
960974527 3:123161594-123161616 GTCAAGCCTCAGCCAGGCCCAGG - Intronic
961544530 3:127623167-127623189 CTGAAGCATAGGGCAGGGCAAGG + Intergenic
963061942 3:141232508-141232530 CTGACGCCTCCGGGAGTCCCGGG + Intronic
968106169 3:196002902-196002924 CTGAAGACTCGGGGAGGAGCTGG - Intergenic
968122612 3:196136288-196136310 CTGTGGCCACTGGCAGGCCCTGG - Intergenic
968379479 4:78256-78278 CTGAGGACTCTGGGAGGCCCAGG - Intronic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
968754001 4:2405539-2405561 CTGTAACCTTGAGCAGGCCCAGG + Intronic
969309360 4:6344168-6344190 CAGAAGGCTCTGGCAGGCCGAGG - Intronic
969333971 4:6495921-6495943 CTGAAGCTTCTGGAAGGCACTGG - Intronic
969749886 4:9101961-9101983 CTGATGCCTAAGGCTGGCCCTGG - Intergenic
974064158 4:57062142-57062164 CGGTAGCATCGGGGAGGCCCTGG - Intronic
981084461 4:140668843-140668865 CTGAAGGCACAGGGAGGCCCTGG + Intronic
981258109 4:142687598-142687620 CGGAAGCCTTGGGCTAGCCCAGG + Intronic
984126941 4:175822831-175822853 CCCCAGCCTCTGGCAGGCCCCGG + Intronic
985163012 4:187063552-187063574 AGGAAGCCTCGGGACGGCCCTGG - Intergenic
985571425 5:647588-647610 CTGCAGCCTGGGGAGGGCCCAGG + Intronic
986293432 5:6418266-6418288 CTGAAGACCTGGACAGGCCCCGG + Intergenic
988065805 5:26228180-26228202 CTGAAGACCCGGGCAGGAGCTGG - Intergenic
989298905 5:39864855-39864877 CTCAACCCTCAAGCAGGCCCCGG + Intergenic
990150340 5:52810295-52810317 CTGGGGCCTGGGGAAGGCCCTGG + Intronic
991396404 5:66209022-66209044 CTGAAGGCTGGGGCTGACCCTGG + Intergenic
991493803 5:67208582-67208604 CTGAGACCCTGGGCAGGCCCTGG + Intergenic
997229421 5:132231833-132231855 CTGATGACTCTTGCAGGCCCTGG + Intronic
997229820 5:132234203-132234225 CTGATGACTCTTGCAGGCCCTGG + Intronic
997820349 5:137060435-137060457 CTCAACCCTCAGGTAGGCCCTGG - Intronic
998164898 5:139837312-139837334 CCGAAGCCCCAGGCAGGACCTGG + Intronic
998394889 5:141812068-141812090 CCGAAGCCTCGTGCAGCCGCAGG + Intergenic
998493683 5:142568472-142568494 TGGAAGCCTCTGGAAGGCCCTGG - Intergenic
999399233 5:151251824-151251846 CTGAACCCCCGGCCAGGCCACGG + Intronic
1002102445 5:176864111-176864133 CTGATGCCAAGGGCAGGCCGGGG + Intronic
1002322547 5:178384379-178384401 GTGAAGCCTCAGGAAAGCCCGGG + Intronic
1002425983 5:179176258-179176280 TTGAAGCCTCTGGCAGGGCAAGG - Intronic
1002596827 5:180329181-180329203 TGGAAGCCACGGGCAGCCCCAGG + Intronic
1002785043 6:393607-393629 CTGAAGGCCCGGCCGGGCCCGGG + Intronic
1003068229 6:2921021-2921043 CTGAGGCCTGAGGCAGGCACAGG - Intergenic
1005243125 6:23854338-23854360 CAGATGCCCCGGGCAGGCACGGG - Intergenic
1006640429 6:35486614-35486636 CAGCAGCCCCGGGGAGGCCCGGG - Exonic
1007281209 6:40713732-40713754 CTGTAGCCTCTGGGAGGACCGGG - Intergenic
1012916832 6:105179841-105179863 CTGAAGCTCCGGGCAGGGCTGGG - Exonic
1018791814 6:167154480-167154502 CTGATACCTCGGCCAGCCCCGGG - Intronic
1018940195 6:168304516-168304538 CAGATGCCACGTGCAGGCCCAGG - Intronic
1019364139 7:622999-623021 CTAAACCCTTGGGCAGACCCTGG + Intronic
1019613830 7:1949863-1949885 CTGCAGCCTCTTGGAGGCCCGGG - Intronic
1021716750 7:23468932-23468954 CTGAAGCAGAGGGCAGGGCCAGG - Intronic
1022352249 7:29577376-29577398 ATGAAGCCTCTGACATGCCCTGG - Intergenic
1023614921 7:42010204-42010226 CTGGAGCCTCGTGCAGGCACAGG - Intronic
1025093380 7:56080833-56080855 CTGCAGGCTGGGGCAGGCCCTGG - Exonic
1025216397 7:57060371-57060393 CTACAGGCTGGGGCAGGCCCTGG - Intergenic
1025627144 7:63232814-63232836 CTGCAGGCTGGGGCAGGCCCTGG - Intergenic
1025654983 7:63510359-63510381 CTACAGGCTGGGGCAGGCCCTGG + Intergenic
1025840403 7:65141272-65141294 CTGCAGCCCCGGGCTGGCCGGGG - Intergenic
1025878311 7:65508892-65508914 CTGCAGCCCCGGGCTGGCCGGGG + Intergenic
1025882654 7:65554692-65554714 CTGCAGCCCCGGGCTGGCCGGGG + Intergenic
1025890789 7:65647911-65647933 CTGCAGCCCCGGGCTGGCCGGGG - Exonic
1027199491 7:76054260-76054282 CTGGAGCCTCAGGCAGGACAAGG - Intronic
1029607311 7:101606664-101606686 CTGAAGCCTCCAGGAGGCTCAGG + Intergenic
1030249574 7:107427635-107427657 CCGAAGCCTCGCTCAGCCCCAGG + Intronic
1031974993 7:128087944-128087966 CTAAAGCCAAGGGCAGCCCCTGG - Intronic
1037806658 8:22061604-22061626 CTGGAGCCTCGGGGAGGCCCTGG - Intronic
1040916475 8:52570361-52570383 CTGTTGCCTCGGGCAGGACAAGG + Intergenic
1041926496 8:63242535-63242557 CAAAAGCCTAGGGCAGGGCCAGG + Intergenic
1043391576 8:79797078-79797100 CTGAACCCGGGGGCATGCCCGGG - Intergenic
1044306382 8:90645668-90645690 CCGAAGCCTCGGGCGGACCGTGG + Exonic
1045552509 8:103185162-103185184 TTGAAGCCTCAGCCAGGCCCTGG + Intronic
1048299476 8:133240674-133240696 CTGAAGCCTCCTGCAGGTCTTGG - Intronic
1049061036 8:140276501-140276523 CAGGAGCCTCGGGGAGGCCCTGG - Intronic
1049433621 8:142576373-142576395 CTGCACCCACGGGCAGGCTCTGG - Intergenic
1049460818 8:142726953-142726975 CTGAAGACGCGGCCTGGCCCTGG - Intergenic
1049570933 8:143369992-143370014 CTGCAGCCTCTGGCACGCCTCGG - Intronic
1049592621 8:143469447-143469469 CTGAAGCCCTGGGCTGGCGCTGG + Intronic
1049734810 8:144199329-144199351 CTGGAGCCACAGGTAGGCCCAGG - Intronic
1049775525 8:144402131-144402153 CTGACGCCTCGGGCTCCCCCAGG + Intronic
1049779692 8:144423277-144423299 CTGAAGCCCAGGGCAGCACCAGG - Intergenic
1049788403 8:144462237-144462259 CTGCAGCCCCGGGCTGGGCCGGG + Intronic
1049788424 8:144462291-144462313 CGGAGGCCTTGGGCAGGTCCAGG + Intronic
1051748704 9:20319340-20319362 CAGAATCCTCGTGAAGGCCCTGG + Intergenic
1053195262 9:36112676-36112698 ATGCAGCCTGGGGAAGGCCCTGG + Intronic
1056114589 9:83429643-83429665 CAGAAGCCTCACGAAGGCCCAGG - Intronic
1057290959 9:93807320-93807342 AGGAAGCCTCAGGCTGGCCCAGG - Intergenic
1057443197 9:95096584-95096606 GTGAAGCCACGGGCAGGACAGGG + Intergenic
1058696657 9:107564654-107564676 CCTCAGCCTCAGGCAGGCCCAGG - Intergenic
1058904707 9:109473278-109473300 CTGAAGCCCCTGGGAAGCCCGGG + Intronic
1060665866 9:125431843-125431865 CAGGAGCCATGGGCAGGCCCAGG - Intergenic
1061043865 9:128153984-128154006 CTGAAGCCAGGGGCAGGGCCAGG + Intergenic
1061456484 9:130701800-130701822 CTGGAGCCTCCTGCTGGCCCAGG - Intronic
1061888696 9:133606293-133606315 CTGAATCCTCCCGCAGGCCTTGG - Intergenic
1061892474 9:133630053-133630075 CAGTTGCCTTGGGCAGGCCCAGG - Intergenic
1062134253 9:134916384-134916406 CTGGGGCCCCGGGCAGCCCCGGG + Exonic
1062204302 9:135327374-135327396 CCGATGCCTCAGGCGGGCCCTGG - Intergenic
1062204309 9:135327385-135327407 CTGAGGCATCGGGCAGCCACGGG + Intergenic
1062634901 9:137485677-137485699 GGGAAGCCTGGGCCAGGCCCTGG + Intronic
1186897818 X:14022176-14022198 CTCAAGCCTCAGGAAGACCCAGG - Intronic
1187464945 X:19518877-19518899 CTGAAGGCTGTGGCAGTCCCTGG - Intergenic
1187868213 X:23743041-23743063 CTAGAGCTTCGGGCTGGCCCCGG - Intronic
1190336731 X:49267205-49267227 CTGGCCCCTTGGGCAGGCCCAGG + Intergenic
1195905931 X:109844502-109844524 CAGAAGCCTGGGGCAGCCCAAGG - Intergenic
1195986132 X:110632292-110632314 ATGCAGCCTCTGACAGGCCCTGG - Intergenic
1199197979 X:145054652-145054674 CTGAACCCTCAAGTAGGCCCTGG - Intergenic
1200061876 X:153487400-153487422 CTGAGGCCTGGGGCAGGGGCTGG + Intronic