ID: 936462831

View in Genome Browser
Species Human (GRCh38)
Location 2:112724782-112724804
Sequence CTGAAGCCTCGGGCAGGCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 296}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936462820_936462831 17 Left 936462820 2:112724742-112724764 CCAGGCTGTGTGTGTGCAGCCCG 0: 1
1: 0
2: 1
3: 23
4: 231
Right 936462831 2:112724782-112724804 CTGAAGCCTCGGGCAGGCCCTGG 0: 1
1: 0
2: 1
3: 30
4: 296
936462823_936462831 -3 Left 936462823 2:112724762-112724784 CCGTGTGCACCCCCAACAGGCTG 0: 1
1: 0
2: 0
3: 19
4: 218
Right 936462831 2:112724782-112724804 CTGAAGCCTCGGGCAGGCCCTGG 0: 1
1: 0
2: 1
3: 30
4: 296
936462822_936462831 -2 Left 936462822 2:112724761-112724783 CCCGTGTGCACCCCCAACAGGCT 0: 1
1: 0
2: 0
3: 7
4: 173
Right 936462831 2:112724782-112724804 CTGAAGCCTCGGGCAGGCCCTGG 0: 1
1: 0
2: 1
3: 30
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936462831 Original CRISPR CTGAAGCCTCGGGCAGGCCC TGG Exonic