ID: 936470299

View in Genome Browser
Species Human (GRCh38)
Location 2:112792645-112792667
Sequence GCACCATGACAGTTTACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936470291_936470299 15 Left 936470291 2:112792607-112792629 CCACCATGACCCCAACAGTCATG No data
Right 936470299 2:112792645-112792667 GCACCATGACAGTTTACAGATGG No data
936470297_936470299 -8 Left 936470297 2:112792630-112792652 CCTGTGCCGGTCTCAGCACCATG No data
Right 936470299 2:112792645-112792667 GCACCATGACAGTTTACAGATGG No data
936470292_936470299 12 Left 936470292 2:112792610-112792632 CCATGACCCCAACAGTCATGCCT No data
Right 936470299 2:112792645-112792667 GCACCATGACAGTTTACAGATGG No data
936470293_936470299 6 Left 936470293 2:112792616-112792638 CCCCAACAGTCATGCCTGTGCCG No data
Right 936470299 2:112792645-112792667 GCACCATGACAGTTTACAGATGG No data
936470294_936470299 5 Left 936470294 2:112792617-112792639 CCCAACAGTCATGCCTGTGCCGG No data
Right 936470299 2:112792645-112792667 GCACCATGACAGTTTACAGATGG No data
936470289_936470299 28 Left 936470289 2:112792594-112792616 CCAAAAGACACTCCCACCATGAC No data
Right 936470299 2:112792645-112792667 GCACCATGACAGTTTACAGATGG No data
936470290_936470299 16 Left 936470290 2:112792606-112792628 CCCACCATGACCCCAACAGTCAT No data
Right 936470299 2:112792645-112792667 GCACCATGACAGTTTACAGATGG No data
936470296_936470299 4 Left 936470296 2:112792618-112792640 CCAACAGTCATGCCTGTGCCGGT No data
Right 936470299 2:112792645-112792667 GCACCATGACAGTTTACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936470299 Original CRISPR GCACCATGACAGTTTACAGA TGG Intergenic
No off target data available for this crispr