ID: 936474011

View in Genome Browser
Species Human (GRCh38)
Location 2:112824051-112824073
Sequence CAGCATGAACAATGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936474011_936474016 -8 Left 936474011 2:112824051-112824073 CCCTCCACCCATTGTTCATGCTG No data
Right 936474016 2:112824066-112824088 TCATGCTGCTTCAGCCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936474011 Original CRISPR CAGCATGAACAATGGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr