ID: 936474998

View in Genome Browser
Species Human (GRCh38)
Location 2:112832178-112832200
Sequence AGATATAAGTTCCTGCTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936474994_936474998 -8 Left 936474994 2:112832163-112832185 CCCGTTACAGCGGAGAGATATAA 0: 1
1: 0
2: 0
3: 2
4: 49
Right 936474998 2:112832178-112832200 AGATATAAGTTCCTGCTGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 119
936474995_936474998 -9 Left 936474995 2:112832164-112832186 CCGTTACAGCGGAGAGATATAAG 0: 1
1: 0
2: 0
3: 5
4: 65
Right 936474998 2:112832178-112832200 AGATATAAGTTCCTGCTGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 119
936474992_936474998 10 Left 936474992 2:112832145-112832167 CCGCACTTGAAACTTTTGCCCGT 0: 1
1: 0
2: 0
3: 5
4: 55
Right 936474998 2:112832178-112832200 AGATATAAGTTCCTGCTGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936474998 Original CRISPR AGATATAAGTTCCTGCTGGG CGG Intronic
903567563 1:24279567-24279589 AGATGATAATTCCTGCTGGGCGG - Intergenic
907202656 1:52741003-52741025 AAATAAAAGTTTTTGCTGGGCGG + Intronic
907892131 1:58646622-58646644 AGATTTCAGGTCCTGGTGGGAGG + Intergenic
912909916 1:113747814-113747836 AGCTAGAAGTTGCTGCTGAGGGG + Intronic
920339478 1:205267069-205267091 AGGTATGAGCACCTGCTGGGAGG + Intronic
922446717 1:225704093-225704115 AGAGCAAAGTGCCTGCTGGGAGG + Intergenic
922758397 1:228109371-228109393 AGATATACGCCCCTGTTGGGCGG + Intergenic
1071296918 10:84227790-84227812 AGATATAAATGGCTGCAGGGAGG + Intergenic
1072028381 10:91489516-91489538 AAATATGAATTCCTGATGGGAGG + Intronic
1074662597 10:115678667-115678689 AGATTTAAGTTCCTTTTGGAAGG - Intronic
1074938616 10:118212654-118212676 AGATATAAATTCTTCCTGGGAGG - Intergenic
1075306073 10:121368412-121368434 AAATGTAACTTCTTGCTGGGGGG - Intergenic
1077871789 11:6269078-6269100 AGAAAGAAGTCCCTTCTGGGAGG + Intronic
1079477989 11:20851357-20851379 AGTTAGAAGTTCCTGATGTGTGG + Intronic
1082682288 11:56190001-56190023 AGATATTACTTCCTGCTTGTGGG + Intergenic
1092322181 12:7487803-7487825 GGCTACAAGTTCCTTCTGGGCGG + Exonic
1098679396 12:73331862-73331884 TGAAATAAGTTAGTGCTGGGTGG - Intergenic
1101665893 12:106814124-106814146 AGAAAAAAGTTCCCACTGGGTGG - Intronic
1108374202 13:49798098-49798120 AGAAATAAGTTTCTGTTGGCCGG + Intergenic
1108457644 13:50632639-50632661 AGACACAAGATACTGCTGGGTGG - Intronic
1111824291 13:93249173-93249195 TGATCTCAGTTCCTGATGGGTGG - Intronic
1114433115 14:22679295-22679317 TGAGATAAGTACCTGGTGGGAGG + Intergenic
1118697060 14:68395459-68395481 AGTTTTAGGTTCCTGCTGGCAGG + Intronic
1120682519 14:87497571-87497593 AGATATAACTTCGAGCTGGCAGG + Intergenic
1121285909 14:92735667-92735689 AGAATTAAGTTCCTGTTAGGAGG - Intronic
1123669429 15:22640168-22640190 AGATATAATTGCCTGCTGCAGGG + Intergenic
1127303226 15:57678016-57678038 AGAGATAAGGTCCTGCTATGTGG - Intronic
1128059758 15:64727883-64727905 TGATATCAGTGACTGCTGGGTGG + Intergenic
1131838279 15:96411275-96411297 TGATATAAGTTGCTGGGGGGAGG - Intergenic
1134208000 16:12253333-12253355 AGATAAAAATTCCTGCTATGTGG + Intronic
1138707439 16:58931208-58931230 AAATATAAGTTTTTGCTGGCAGG - Intergenic
1142804426 17:2363972-2363994 AGAAATGAGCTCCCGCTGGGAGG - Intronic
1145300004 17:21627209-21627231 AGCCAGGAGTTCCTGCTGGGAGG + Intergenic
1146562677 17:33884656-33884678 AGATATAAGAGCCTGCATGGAGG - Intronic
1148044131 17:44732091-44732113 AGATAGAAATTGCTTCTGGGAGG - Intronic
1148095440 17:45050021-45050043 AGAAAAAATTACCTGCTGGGAGG - Intronic
1148558282 17:48591562-48591584 AGATTTAAGTTCCTGCTGCCTGG - Exonic
1149203810 17:54219780-54219802 AGATTTAATTTCATGCTGTGGGG - Intergenic
1151436006 17:74097946-74097968 CGAGAAAAGTTCCTGCTGGTAGG + Intergenic
1152901200 17:82942005-82942027 AGATATAACCTCCTGCCGGAAGG - Intronic
1155847813 18:30731367-30731389 TGGTTGAAGTTCCTGCTGGGAGG - Intergenic
1155865712 18:30962560-30962582 AGATATAACTTCATGTTTGGAGG + Intergenic
1160345995 18:78132410-78132432 AGATGTCAATTTCTGCTGGGGGG - Intergenic
1160810538 19:1011184-1011206 AGATAGAAGAACCTGCGGGGCGG + Exonic
1162555753 19:11384385-11384407 AGAGATAAGTGCCTGGCGGGAGG + Intronic
1162922608 19:13912481-13912503 GGATATAAGGGCCTGCTGGATGG - Intronic
1165730431 19:38141432-38141454 AGAGGTAAGCACCTGCTGGGGGG + Exonic
927593160 2:24374162-24374184 AGATAGAAGTTCCTGGAGAGTGG + Intergenic
931398514 2:61909368-61909390 AGATATCAGTTCTTTCTGGCAGG + Intronic
931793638 2:65688946-65688968 AGATAAAGCCTCCTGCTGGGAGG - Intergenic
931968860 2:67564031-67564053 AGATATAAAATGCTGCTGGAGGG + Intergenic
935642890 2:105307628-105307650 AGACAGGAGTTCCTGCTGGCGGG - Exonic
936474998 2:112832178-112832200 AGATATAAGTTCCTGCTGGGCGG + Intronic
936639424 2:114295447-114295469 AGATTTCAGTGCTTGCTGGGTGG - Intergenic
938442356 2:131347324-131347346 AGATATAATCTCCTGGTGTGCGG + Intronic
942501485 2:176595322-176595344 AGAGATATGTATCTGCTGGGAGG + Intergenic
946463541 2:219891223-219891245 AGATACCAGCTCCTGATGGGAGG + Intergenic
1175745370 20:61453328-61453350 AGATGCAAGTTCCTGTGGGGCGG + Intronic
1175911053 20:62405793-62405815 AGGTCCAAGTGCCTGCTGGGCGG - Intronic
1178145116 21:29730271-29730293 AGATAAAATTTCCTTCTGAGTGG - Intronic
1179068305 21:38047520-38047542 AGATATAAGATACCTCTGGGAGG - Intronic
1179723146 21:43326813-43326835 AGATCTAAATTCCTGTTGGCAGG + Intergenic
1180686760 22:17674321-17674343 AGAGATAGGTTCTTGCTGGCGGG + Intronic
954433660 3:50484664-50484686 GGAGATCAGTTGCTGCTGGGGGG - Intronic
955190555 3:56757488-56757510 AGTTATAATTACCTGCTGGATGG + Intronic
956309553 3:67863928-67863950 AGATTTGTGTTCCTGCTGGTGGG + Intergenic
958099080 3:88985668-88985690 AGACATTAGTTGCTGCTGTGAGG + Intergenic
960561310 3:119086566-119086588 GCTTATAAGTTCCTGCTGAGAGG - Intronic
961843704 3:129741085-129741107 AGATAATAGATCCTGGTGGGTGG - Intronic
963313163 3:143730406-143730428 AGATATAAATTCATGCAGAGAGG - Intronic
963955494 3:151249228-151249250 AGATCTATCTTCCTGCTGGCTGG - Intronic
965403027 3:168236205-168236227 CCATATTAGTTACTGCTGGGAGG + Intergenic
973154409 4:46932046-46932068 AGATCAAAGGTCCTGATGGGAGG + Intronic
973312637 4:48726112-48726134 AGATATAAGTTCTTTTTGTGGGG + Intronic
974518901 4:62955288-62955310 AGTTATAAGTACATGCTGGCTGG - Intergenic
975074946 4:70194579-70194601 AGATATAAAGTCCTACTGGTGGG + Intergenic
976379987 4:84388414-84388436 AGAGCTTATTTCCTGCTGGGCGG - Intergenic
977360892 4:96002688-96002710 AGATATAAATTCATGCTCGTGGG - Intergenic
981841320 4:149115972-149115994 AGAAATAAGGACCTGCTGGGAGG - Intergenic
982164304 4:152601117-152601139 AGAAATACGTTTCTACTGGGGGG + Intergenic
983227036 4:165095031-165095053 AGAAATAAGTTCCTGTGGGCTGG + Intronic
983985286 4:174052342-174052364 AGATATGGTTTCATGCTGGGAGG + Intergenic
986475104 5:8121558-8121580 AGATTGATGTTCCTGTTGGGGGG + Intergenic
987356731 5:17069931-17069953 AAATATTAGTTCTTGCTGGGTGG + Intronic
987641624 5:20619161-20619183 AGTTAGAAATACCTGCTGGGTGG - Intergenic
989753227 5:44921113-44921135 AGAAATTAGTTCATGCTGGCTGG + Intergenic
989975184 5:50577159-50577181 AGATTTGGGTTCCTGCTGGAGGG - Intergenic
991476877 5:67031151-67031173 TAATATCAGTTCCTGGTGGGTGG + Intronic
992423404 5:76629696-76629718 AAAAATTAGTTCCTGCAGGGAGG - Intronic
993755241 5:91721088-91721110 TGATATGAGTTCTTTCTGGGTGG + Intergenic
994044865 5:95296270-95296292 AGTTATAGGTACCTGATGGGGGG - Intergenic
994603758 5:101941472-101941494 TGATAAAAGTTTCTGCTGAGAGG + Intergenic
995397830 5:111706808-111706830 AGATAATAGTTCGTGATGGGTGG + Intronic
996208909 5:120780760-120780782 AAATATAATTTCCGGCCGGGCGG + Intergenic
996412239 5:123170885-123170907 AGAGAGAAGTTCCTGCTGCACGG - Exonic
997412052 5:133697839-133697861 ACAGATAATTTCCTGCTGGAGGG + Intergenic
999878048 5:155830229-155830251 AGATAAAAGTGCCAGCAGGGTGG + Intergenic
1003341168 6:5222138-5222160 AGATTAAAGTTCCTGCTATGTGG - Intronic
1003806665 6:9733116-9733138 AGATCTAACTTCCTGCTCTGTGG - Intronic
1005039070 6:21585649-21585671 AAATATAAGTTCATGCAGGAAGG - Intergenic
1005945918 6:30595761-30595783 AGAGAAAAGTGCCTGCAGGGAGG + Intronic
1006377780 6:33681233-33681255 AGTTAGGAGTTCCTGCTGGATGG - Intronic
1016860763 6:148716518-148716540 ATATATAAGTGCCTCCTTGGTGG - Intergenic
1019304526 7:326740-326762 AGCTATTAGTGCCTGCTGGTGGG - Intergenic
1026175688 7:67994899-67994921 AGATATAAGTACCAGCTTAGAGG + Intergenic
1027588919 7:80092890-80092912 AGATGTGAGTTCTTGCTGAGAGG - Intergenic
1028932268 7:96426692-96426714 ACATACAATTTCCTTCTGGGTGG - Intergenic
1031005636 7:116467869-116467891 AGATTTAAGCTGCTGCTGTGAGG - Intronic
1033780733 7:144666002-144666024 AGGTTTTAGTTCCTGCTGTGAGG - Intronic
1037404580 8:18528168-18528190 AGATATAAGAGACTGCAGGGAGG + Exonic
1043052159 8:75397555-75397577 AGATATTACTTCCTGATGGGAGG - Intergenic
1043233007 8:77825970-77825992 AGATGTAAGCTCCTGCTTTGAGG + Intergenic
1048512968 8:135079009-135079031 GGTTATAAGTGCCTGCAGGGTGG - Intergenic
1049333425 8:142068389-142068411 AGATTCAAGTCCCTGGTGGGAGG - Intergenic
1051774949 9:20622689-20622711 AGTAACAGGTTCCTGCTGGGGGG + Intergenic
1056057629 9:82843964-82843986 AGATATTCCTTCCAGCTGGGTGG + Intergenic
1059799641 9:117737375-117737397 AGAAATAAGTTCCTGGACGGAGG - Intergenic
1203628352 Un_KI270750v1:46907-46929 AGCCAGAAGTTCCTGCTGAGAGG + Intergenic
1188538566 X:31224010-31224032 AAATATAGCTTCCTGCTAGGTGG - Intronic
1188791936 X:34415466-34415488 AGATATAATCTCCTGGTGCGCGG - Intergenic
1196179273 X:112672266-112672288 AGCTATATGTTCCTGCTGCAAGG - Intronic
1197647512 X:129033985-129034007 AGGTATATGTTTCTGTTGGGTGG - Intergenic
1200700127 Y:6395041-6395063 AGAGACAAGTTCCTGCAGGTTGG - Intergenic
1201033984 Y:9769657-9769679 AGAGACAAGTTCCTGCAGGTTGG + Intergenic
1201567901 Y:15385621-15385643 AGATATAAGATCCTGCTCTCAGG + Intergenic