ID: 936475837

View in Genome Browser
Species Human (GRCh38)
Location 2:112839047-112839069
Sequence CCGCATAAAGACTCTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 95}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936475837_936475843 -3 Left 936475837 2:112839047-112839069 CCTTCCTCAGAGTCTTTATGCGG 0: 1
1: 0
2: 1
3: 7
4: 95
Right 936475843 2:112839067-112839089 CGGCAACCAGCAGGGTCTGGAGG 0: 1
1: 0
2: 0
3: 26
4: 243
936475837_936475844 -2 Left 936475837 2:112839047-112839069 CCTTCCTCAGAGTCTTTATGCGG 0: 1
1: 0
2: 1
3: 7
4: 95
Right 936475844 2:112839068-112839090 GGCAACCAGCAGGGTCTGGAGGG 0: 1
1: 0
2: 1
3: 27
4: 279
936475837_936475845 2 Left 936475837 2:112839047-112839069 CCTTCCTCAGAGTCTTTATGCGG 0: 1
1: 0
2: 1
3: 7
4: 95
Right 936475845 2:112839072-112839094 ACCAGCAGGGTCTGGAGGGTTGG 0: 1
1: 0
2: 4
3: 40
4: 326
936475837_936475847 5 Left 936475837 2:112839047-112839069 CCTTCCTCAGAGTCTTTATGCGG 0: 1
1: 0
2: 1
3: 7
4: 95
Right 936475847 2:112839075-112839097 AGCAGGGTCTGGAGGGTTGGTGG 0: 1
1: 0
2: 9
3: 66
4: 557
936475837_936475842 -6 Left 936475837 2:112839047-112839069 CCTTCCTCAGAGTCTTTATGCGG 0: 1
1: 0
2: 1
3: 7
4: 95
Right 936475842 2:112839064-112839086 ATGCGGCAACCAGCAGGGTCTGG 0: 1
1: 0
2: 0
3: 10
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936475837 Original CRISPR CCGCATAAAGACTCTGAGGA AGG (reversed) Intergenic
908085047 1:60622947-60622969 CCCCATTAAGCCTCTGAGGGTGG + Intergenic
908163713 1:61437010-61437032 ACACATTCAGACTCTGAGGAAGG - Intronic
909033369 1:70568005-70568027 CCTGATTCAGACTCTGAGGATGG + Intergenic
917689908 1:177458160-177458182 TAGCATACAGACTCTGAAGAAGG - Intergenic
920029568 1:203028388-203028410 CCTCACAGAGCCTCTGAGGATGG + Intronic
920852238 1:209635931-209635953 CTGGACAAAGGCTCTGAGGAGGG - Intronic
922318729 1:224465503-224465525 CAGCATAAAAGCTATGAGGAGGG - Intronic
1063614885 10:7592920-7592942 CAGCATGGAGACTCTCAGGAGGG - Intronic
1063968252 10:11363410-11363432 GCGCAGGAAGGCTCTGAGGAAGG + Intergenic
1068592855 10:58867742-58867764 CCACAAAAATACCCTGAGGAAGG - Intergenic
1069807743 10:71136550-71136572 CCACCTCCAGACTCTGAGGAAGG + Intergenic
1071366752 10:84908030-84908052 CCGCAGGAGGAGTCTGAGGAGGG - Intergenic
1080027327 11:27628232-27628254 CTGCATAAAGATACAGAGGAAGG - Intergenic
1081569879 11:44283542-44283564 CAGAATAAAGACTATCAGGAAGG - Intronic
1083084144 11:60125110-60125132 CTGCTCAAAGACCCTGAGGAGGG - Intergenic
1084536464 11:69760371-69760393 CCTCATAATGACTGTGAGAAGGG + Intergenic
1088343966 11:108801646-108801668 CTTCATAAAGAATTTGAGGATGG + Intronic
1088808021 11:113369498-113369520 CCTCATAACGACTGTGAGGTGGG + Intronic
1090479877 11:127058736-127058758 TTGCATAAAGACCCTGAGGTGGG - Intergenic
1090529856 11:127579170-127579192 CCCCAAAAAGAATCTGAGGCAGG + Intergenic
1090716099 11:129432879-129432901 CCGGCCAAAGACACTGAGGAGGG - Intronic
1095486847 12:42694334-42694356 CCGCAAAAAGCCTGTGAGGGTGG - Intergenic
1096543252 12:52320411-52320433 CCCCATAAAGCCTGTGAGGATGG + Intronic
1098963420 12:76762706-76762728 CCGCCAAAGGAGTCTGAGGAGGG - Intergenic
1099330759 12:81283023-81283045 ACACAGAAAGAATCTGAGGAAGG - Exonic
1102042234 12:109808402-109808424 CCGGTTGAAGACTTTGAGGATGG + Exonic
1104583822 12:130031036-130031058 CAGAAAAAAGAATCTGAGGAGGG - Intergenic
1106388134 13:29307881-29307903 CTGCATGGAAACTCTGAGGAGGG - Intronic
1110270494 13:73584194-73584216 CAGCATAAAGGCCCTGAGGTAGG + Intergenic
1110420715 13:75304693-75304715 CCGCATAAAGGCCCTGAGACGGG + Intronic
1111660845 13:91208762-91208784 CCTCATAAAAACCCTGAGGTAGG + Intergenic
1117372799 14:55094155-55094177 CCCCATAAAAACTATGGGGATGG + Intergenic
1125361921 15:38873419-38873441 CAGCTAAAAGACTCTGAGGAAGG + Intergenic
1125817585 15:42600002-42600024 CAGCTTAAAGACTCTAAGGCAGG + Intronic
1126745923 15:51826583-51826605 CAGCATAAAGACTCTGAGATGGG + Intergenic
1130629870 15:85556187-85556209 CCTCACAAAAACTCTGAGGCAGG - Intronic
1131399446 15:92112760-92112782 GCGCATGAAGGCTCTGAGAAGGG + Intronic
1133895369 16:9922434-9922456 CCTCATAAAAACTCGGATGAAGG + Intronic
1139611999 16:68065845-68065867 CCTCAGAATGATTCTGAGGACGG + Intronic
1144520741 17:15950922-15950944 GCGCAGAGAGACTCTGAGTAAGG - Intronic
1146927341 17:36754178-36754200 CAGCACAAAGGCCCTGAGGAAGG + Intergenic
1148032408 17:44630411-44630433 CATAATAAAGACTTTGAGGAGGG - Intergenic
1151447477 17:74176645-74176667 CCGAATAAAGACACTGAACAAGG + Intergenic
1152001708 17:77650004-77650026 CTGCTTACAGACCCTGAGGAGGG + Intergenic
1155778442 18:29798437-29798459 CAATATTAAGACTCTGAGGAGGG + Intergenic
1156864127 18:41869533-41869555 GCACACAAAGACTCTGGGGAGGG + Intergenic
1157247840 18:46070154-46070176 CAGCATGAAGCCTCTGAGGTGGG - Intronic
1168397419 19:56060590-56060612 CGGCACAGAGACTCTGAGGAAGG + Intronic
932720934 2:74138677-74138699 CCACGTAAAGGCTCTGAGCAGGG + Intronic
936475837 2:112839047-112839069 CCGCATAAAGACTCTGAGGAAGG - Intergenic
936828639 2:116612536-116612558 CCAGATAGAGACACTGAGGACGG + Intergenic
937949128 2:127370256-127370278 CCGCCCACAGACACTGAGGAGGG - Intronic
939414694 2:141880200-141880222 CCTCATTCAGATTCTGAGGAAGG + Intronic
941844489 2:170119668-170119690 CCGTTTACAGACCCTGAGGAGGG - Intergenic
942448097 2:176091878-176091900 CCGCAGAAAGACCCTGAGAACGG - Intergenic
1169470042 20:5877332-5877354 TCCCATAATGACTCTGAGTATGG - Intergenic
1170914116 20:20605984-20606006 AGGCATGAAGACTCCGAGGAAGG - Intronic
1179678647 21:43002246-43002268 CCCCATTAAAACTCTGAGCAAGG - Intronic
1183660234 22:39215807-39215829 CCAGCTGAAGACTCTGAGGATGG - Intergenic
954557699 3:51531304-51531326 CAGCATTAAGACTGTGATGAGGG + Intergenic
957940587 3:86997820-86997842 TCATATAAAGACTCTGAGGCTGG + Intergenic
959148309 3:102576221-102576243 CAGCATAAAGACACCAAGGAAGG + Intergenic
966892236 3:184415962-184415984 CATCGTAAAGGCTCTGAGGATGG - Intronic
969862528 4:10048751-10048773 ATGCTTCAAGACTCTGAGGATGG - Intronic
970395087 4:15656749-15656771 CCTCATAAAGATTCTGAGGTAGG - Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977194555 4:94043447-94043469 CCACATAATGACCCTGAAGAGGG + Intergenic
978848979 4:113310299-113310321 AAGCAAACAGACTCTGAGGAGGG + Intronic
981327925 4:143473380-143473402 GCAGATAAAGACTCTAAGGAAGG - Exonic
986712040 5:10494766-10494788 CCGCTCACAGACACTGAGGAGGG - Intergenic
989350065 5:40475954-40475976 CAGCATAAATACCATGAGGAGGG + Intergenic
991678191 5:69109890-69109912 CCGCTTACAGACCCTAAGGAGGG + Intronic
995283504 5:110360881-110360903 GTGCATAAAGAGTCTGAGGATGG - Intronic
997642899 5:135461273-135461295 TCGCATCAAGACTCTCTGGAAGG - Intergenic
998880434 5:146640021-146640043 CCGCATCTAAACTCTAAGGAGGG - Intronic
1000550412 5:162655195-162655217 ATGTACAAAGACTCTGAGGATGG - Intergenic
1004039216 6:11959358-11959380 GAGCATGAAGTCTCTGAGGAGGG - Intergenic
1006791608 6:36704817-36704839 CCCCATAAAGAGTCTTAGGGTGG + Intronic
1007156964 6:39754238-39754260 CAGCATAAAGATTTTGAGGTGGG - Intergenic
1012341679 6:98133348-98133370 CCAGATACAGAATCTGAGGAGGG + Intergenic
1017975306 6:159351963-159351985 AAGCATAGAAACTCTGAGGATGG - Intergenic
1029463091 7:100707420-100707442 CCGCATACACACACTCAGGAAGG - Exonic
1032176677 7:129635106-129635128 CCGCCTAGAGACCCTGAGAAAGG - Intronic
1034217560 7:149420210-149420232 CAGCACAGAGTCTCTGAGGAAGG - Intergenic
1034221636 7:149451025-149451047 GAGCAGGAAGACTCTGAGGAGGG - Exonic
1036005363 8:4656171-4656193 CCCCATAAGAACACTGAGGAAGG + Intronic
1036614030 8:10374452-10374474 CCGCAAGAACACTATGAGGAAGG + Intronic
1037579313 8:20235335-20235357 CCGCATAAAGACACAGAGACAGG + Intergenic
1040359511 8:46651854-46651876 CCACTTACAGACCCTGAGGAGGG - Intergenic
1040816493 8:51513267-51513289 CGGCATAAACACTCTGAGGATGG + Intronic
1048002798 8:130393453-130393475 CCTCACAAAGACTCCTAGGAAGG + Intronic
1049746008 8:144263598-144263620 CCGCATCCAGGCTCTGACGACGG - Exonic
1050430390 9:5556216-5556238 TTGCATAAAGACACTGAGGTAGG + Intronic
1050758490 9:9037323-9037345 TCCTATAAAGAGTCTGAGGAAGG + Intronic
1053366295 9:37524792-37524814 CCGCACAAAGACCAAGAGGAGGG + Intronic
1055076579 9:72221308-72221330 CCACATTAAGGCTCTGATGAAGG - Intronic
1055821304 9:80267808-80267830 CCTCAGAAAAACTCTAAGGATGG - Intergenic
1059963549 9:119591279-119591301 AGGCATAGAGACTCTGAGAATGG + Intergenic
1062695482 9:137873687-137873709 CAGCAGAAGGACTCTGAGGTTGG + Intergenic
1062712365 9:137983456-137983478 CCTCAGATAGACTGTGAGGAGGG - Intronic
1203787523 EBV:136276-136298 CCGCGTGGAGACTCTGAGGCAGG + Intergenic
1192151307 X:68714352-68714374 CAGCATCAAGGCTCTGAAGAGGG - Intronic
1197095442 X:122589074-122589096 CAAAATAATGACTCTGAGGAGGG - Intergenic
1199271067 X:145883196-145883218 CAGTGTAAAGACTCTGAGGTGGG - Intergenic