ID: 936476322

View in Genome Browser
Species Human (GRCh38)
Location 2:112843131-112843153
Sequence TCACCTCCATGACTGGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936476315_936476322 20 Left 936476315 2:112843088-112843110 CCCTTGCTGTCAATGCACCTGAT No data
Right 936476322 2:112843131-112843153 TCACCTCCATGACTGGCTCATGG No data
936476316_936476322 19 Left 936476316 2:112843089-112843111 CCTTGCTGTCAATGCACCTGATT No data
Right 936476322 2:112843131-112843153 TCACCTCCATGACTGGCTCATGG No data
936476320_936476322 3 Left 936476320 2:112843105-112843127 CCTGATTCAGGGCTGGCATATAC No data
Right 936476322 2:112843131-112843153 TCACCTCCATGACTGGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936476322 Original CRISPR TCACCTCCATGACTGGCTCA TGG Intergenic