ID: 936477791

View in Genome Browser
Species Human (GRCh38)
Location 2:112855085-112855107
Sequence TCCCATGCCTCCTGTGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936477783_936477791 17 Left 936477783 2:112855045-112855067 CCTCCGCCTCCCAGGTTCAAGTG 0: 5962
1: 33452
2: 79859
3: 125271
4: 132601
Right 936477791 2:112855085-112855107 TCCCATGCCTCCTGTGTAGCTGG No data
936477787_936477791 7 Left 936477787 2:112855055-112855077 CCAGGTTCAAGTGATTCTCCTGC 0: 33779
1: 81745
2: 101616
3: 124160
4: 74442
Right 936477791 2:112855085-112855107 TCCCATGCCTCCTGTGTAGCTGG No data
936477786_936477791 8 Left 936477786 2:112855054-112855076 CCCAGGTTCAAGTGATTCTCCTG 0: 19726
1: 81126
2: 140864
3: 165550
4: 182302
Right 936477791 2:112855085-112855107 TCCCATGCCTCCTGTGTAGCTGG No data
936477785_936477791 11 Left 936477785 2:112855051-112855073 CCTCCCAGGTTCAAGTGATTCTC 0: 20599
1: 62494
2: 120157
3: 154110
4: 162194
Right 936477791 2:112855085-112855107 TCCCATGCCTCCTGTGTAGCTGG No data
936477784_936477791 14 Left 936477784 2:112855048-112855070 CCGCCTCCCAGGTTCAAGTGATT 0: 13227
1: 40037
2: 76891
3: 95818
4: 102901
Right 936477791 2:112855085-112855107 TCCCATGCCTCCTGTGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936477791 Original CRISPR TCCCATGCCTCCTGTGTAGC TGG Intergenic
No off target data available for this crispr