ID: 936479865

View in Genome Browser
Species Human (GRCh38)
Location 2:112876397-112876419
Sequence TAGAGATTATTGAACTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936479862_936479865 -2 Left 936479862 2:112876376-112876398 CCAGCAAACACTAATCCTTTCTA No data
Right 936479865 2:112876397-112876419 TAGAGATTATTGAACTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936479865 Original CRISPR TAGAGATTATTGAACTCTGG AGG Intergenic
No off target data available for this crispr