ID: 936480408

View in Genome Browser
Species Human (GRCh38)
Location 2:112880083-112880105
Sequence GGTGATGGGGAGTCAAGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936480393_936480408 21 Left 936480393 2:112880039-112880061 CCTTCCCCATTTACTGGCCTTGT No data
Right 936480408 2:112880083-112880105 GGTGATGGGGAGTCAAGAGGGGG No data
936480390_936480408 24 Left 936480390 2:112880036-112880058 CCCCCTTCCCCATTTACTGGCCT No data
Right 936480408 2:112880083-112880105 GGTGATGGGGAGTCAAGAGGGGG No data
936480391_936480408 23 Left 936480391 2:112880037-112880059 CCCCTTCCCCATTTACTGGCCTT No data
Right 936480408 2:112880083-112880105 GGTGATGGGGAGTCAAGAGGGGG No data
936480392_936480408 22 Left 936480392 2:112880038-112880060 CCCTTCCCCATTTACTGGCCTTG No data
Right 936480408 2:112880083-112880105 GGTGATGGGGAGTCAAGAGGGGG No data
936480400_936480408 -3 Left 936480400 2:112880063-112880085 CCCAAAGCTGGACGTGCTGTGGT No data
Right 936480408 2:112880083-112880105 GGTGATGGGGAGTCAAGAGGGGG No data
936480395_936480408 16 Left 936480395 2:112880044-112880066 CCCATTTACTGGCCTTGTACCCA No data
Right 936480408 2:112880083-112880105 GGTGATGGGGAGTCAAGAGGGGG No data
936480401_936480408 -4 Left 936480401 2:112880064-112880086 CCAAAGCTGGACGTGCTGTGGTG No data
Right 936480408 2:112880083-112880105 GGTGATGGGGAGTCAAGAGGGGG No data
936480394_936480408 17 Left 936480394 2:112880043-112880065 CCCCATTTACTGGCCTTGTACCC No data
Right 936480408 2:112880083-112880105 GGTGATGGGGAGTCAAGAGGGGG No data
936480398_936480408 4 Left 936480398 2:112880056-112880078 CCTTGTACCCAAAGCTGGACGTG No data
Right 936480408 2:112880083-112880105 GGTGATGGGGAGTCAAGAGGGGG No data
936480396_936480408 15 Left 936480396 2:112880045-112880067 CCATTTACTGGCCTTGTACCCAA No data
Right 936480408 2:112880083-112880105 GGTGATGGGGAGTCAAGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936480408 Original CRISPR GGTGATGGGGAGTCAAGAGG GGG Intergenic
No off target data available for this crispr