ID: 936490025

View in Genome Browser
Species Human (GRCh38)
Location 2:112961952-112961974
Sequence CATGGTGGCCACGGTGTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936490018_936490025 23 Left 936490018 2:112961906-112961928 CCAGCTGTGGTGCCTGAGGCACC No data
Right 936490025 2:112961952-112961974 CATGGTGGCCACGGTGTAGTTGG No data
936490020_936490025 2 Left 936490020 2:112961927-112961949 CCTGTGTCTTCACAGCACCAACT No data
Right 936490025 2:112961952-112961974 CATGGTGGCCACGGTGTAGTTGG No data
936490019_936490025 11 Left 936490019 2:112961918-112961940 CCTGAGGCACCTGTGTCTTCACA No data
Right 936490025 2:112961952-112961974 CATGGTGGCCACGGTGTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936490025 Original CRISPR CATGGTGGCCACGGTGTAGT TGG Intergenic
No off target data available for this crispr