ID: 936490715

View in Genome Browser
Species Human (GRCh38)
Location 2:112969808-112969830
Sequence GACCCCCATGGAGCACTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936490712_936490715 6 Left 936490712 2:112969779-112969801 CCTCACAGGCTAATAAGAGGTCT No data
Right 936490715 2:112969808-112969830 GACCCCCATGGAGCACTGACAGG No data
936490710_936490715 14 Left 936490710 2:112969771-112969793 CCAAGTTGCCTCACAGGCTAATA No data
Right 936490715 2:112969808-112969830 GACCCCCATGGAGCACTGACAGG No data
936490708_936490715 20 Left 936490708 2:112969765-112969787 CCTGAGCCAAGTTGCCTCACAGG No data
Right 936490715 2:112969808-112969830 GACCCCCATGGAGCACTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936490715 Original CRISPR GACCCCCATGGAGCACTGAC AGG Intergenic
No off target data available for this crispr