ID: 936493884

View in Genome Browser
Species Human (GRCh38)
Location 2:113000330-113000352
Sequence CAGCTATAACCACTATCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936493884_936493888 -7 Left 936493884 2:113000330-113000352 CCCCTGGATAGTGGTTATAGCTG No data
Right 936493888 2:113000346-113000368 ATAGCTGAGGTTCTGAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936493884 Original CRISPR CAGCTATAACCACTATCCAG GGG (reversed) Intergenic
No off target data available for this crispr