ID: 936495554

View in Genome Browser
Species Human (GRCh38)
Location 2:113017494-113017516
Sequence AAGGAGAAGGAGAAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8450
Summary {0: 25, 1: 106, 2: 378, 3: 1647, 4: 6294}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936495548_936495554 17 Left 936495548 2:113017454-113017476 CCTGGGTAACACAGCAGGACTCT No data
Right 936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG 0: 25
1: 106
2: 378
3: 1647
4: 6294
936495547_936495554 21 Left 936495547 2:113017450-113017472 CCAGCCTGGGTAACACAGCAGGA No data
Right 936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG 0: 25
1: 106
2: 378
3: 1647
4: 6294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936495554 Original CRISPR AAGGAGAAGGAGAAGGAGAA GGG Intergenic
Too many off-targets to display for this crispr