ID: 936502078

View in Genome Browser
Species Human (GRCh38)
Location 2:113074481-113074503
Sequence CTGCTGACCCTCTGCTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 308}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936502078_936502083 2 Left 936502078 2:113074481-113074503 CCTCCCCAGCAGAGGGTCAGCAG 0: 1
1: 0
2: 4
3: 35
4: 308
Right 936502083 2:113074506-113074528 GCCCCCAGTGACAGTGAGAAGGG 0: 1
1: 0
2: 1
3: 26
4: 195
936502078_936502082 1 Left 936502078 2:113074481-113074503 CCTCCCCAGCAGAGGGTCAGCAG 0: 1
1: 0
2: 4
3: 35
4: 308
Right 936502082 2:113074505-113074527 TGCCCCCAGTGACAGTGAGAAGG 0: 1
1: 0
2: 5
3: 31
4: 223
936502078_936502088 19 Left 936502078 2:113074481-113074503 CCTCCCCAGCAGAGGGTCAGCAG 0: 1
1: 0
2: 4
3: 35
4: 308
Right 936502088 2:113074523-113074545 GAAGGGCCAGAGAGCAGCTGTGG 0: 1
1: 0
2: 4
3: 54
4: 548

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936502078 Original CRISPR CTGCTGACCCTCTGCTGGGG AGG (reversed) Intronic
900095690 1:939263-939285 CAGCAGCGCCTCTGCTGGGGAGG - Exonic
900344238 1:2203550-2203572 CTGGTGCCCCTCACCTGGGGTGG + Intronic
900591981 1:3464212-3464234 CGGCAGACCCTTTGCTGGGCAGG + Intronic
900698175 1:4025910-4025932 CGGCTGTTCCTCTGCTGGGAAGG - Intergenic
901080138 1:6579577-6579599 CTGCTGACCCACTGGTCAGGTGG - Exonic
901263006 1:7887311-7887333 CTGCTCACACCCTGCTGTGGAGG - Intergenic
901503598 1:9669741-9669763 CTGCTGACCTGCTGTTGAGGAGG + Intronic
901673236 1:10867893-10867915 CTGCAGACGATCTGCTTGGGTGG + Intergenic
902645313 1:17793722-17793744 CTGGTGATCTTCTGCTGTGGTGG + Intronic
902711456 1:18242868-18242890 TGGCTCACACTCTGCTGGGGGGG + Intronic
902876112 1:19341882-19341904 CTGCTGCACCCCTTCTGGGGTGG + Intronic
903036566 1:20496762-20496784 CTGCTGCTCCGCTTCTGGGGAGG - Intergenic
903848279 1:26291167-26291189 CTGCTCTCCCTCTGTTGGAGAGG - Intronic
905410537 1:37765231-37765253 CTTCCCACCCTCTGCTGGCGGGG - Intergenic
905532666 1:38694505-38694527 ATTCTGCCCCTCTGTTGGGGAGG - Intergenic
905866736 1:41380956-41380978 CTGTTAACCCTTTGCTGGGAGGG - Intronic
910619382 1:89236207-89236229 CTGCCGTCCCTCGCCTGGGGAGG + Intergenic
910973730 1:92883866-92883888 TTGCTGATCCTCTTCTGGGGTGG - Intronic
912544205 1:110439276-110439298 CAGCTGACCCTCTGTCAGGGAGG - Intergenic
915526685 1:156480463-156480485 CTGCTGAGACTCTACTGGGATGG - Intronic
915583342 1:156829463-156829485 CTGCAGAACCTGGGCTGGGGAGG - Intronic
920375487 1:205505690-205505712 CTGCAGACCTTGTGCTGGGTGGG + Intronic
921166692 1:212513150-212513172 CCACTGACCCTCTGGTGGGGAGG + Intergenic
921277204 1:213532197-213532219 CTTCTGCCCATCTGCTGGGATGG - Intergenic
922238429 1:223738762-223738784 CTCCAGACCCTCTTCTGGGAAGG - Intronic
922463291 1:225829049-225829071 CTGCTTTTCCTCTGCTGGGCAGG + Intronic
922571955 1:226639675-226639697 CTGCTGACCCCCTCCTGGGTGGG - Intronic
1063145310 10:3290498-3290520 GTGCTGGCCCTCACCTGGGGTGG + Intergenic
1065159666 10:22906673-22906695 TTGCTGACCCTGTGTTTGGGAGG - Intergenic
1065705949 10:28471738-28471760 CCGCTGACCCTGAGCTGGTGGGG - Intergenic
1067078278 10:43200243-43200265 CTGCTGACCCTGTCCTGGGGTGG + Exonic
1067090653 10:43264500-43264522 CTGCCCACTCCCTGCTGGGGAGG - Intronic
1067479829 10:46587493-46587515 CTGCTGGCTCTCTGCAGGGGAGG - Exonic
1067614908 10:47754304-47754326 CTGCTGGCTCTCTGCAGGGGAGG + Intergenic
1070529856 10:77327112-77327134 CTGCTAACCCACTGCTAGGAGGG - Intronic
1070684932 10:78473168-78473190 CTGGTGACTCTCAGCTGGGGTGG + Intergenic
1071230437 10:83579857-83579879 CTGCTGACCCTAAGCTGGGGAGG - Intergenic
1071630314 10:87214268-87214290 CTGCTGGCTCTCTGCAGGGGAGG + Intergenic
1073382162 10:103086953-103086975 CCACTGACCAACTGCTGGGGAGG + Exonic
1073468495 10:103708404-103708426 CTGGTGCCCTTCTCCTGGGGAGG - Intronic
1074870895 10:117575285-117575307 GTGCTGACCCTCTTGTTGGGTGG + Intergenic
1075280767 10:121136300-121136322 CTCTTGAGCCCCTGCTGGGGAGG + Intergenic
1075361364 10:121838224-121838246 GTGCCAACCCACTGCTGGGGTGG - Intronic
1075731502 10:124639241-124639263 ATCCTGACCTCCTGCTGGGGTGG - Intronic
1076324246 10:129609048-129609070 CTGCTGGGCCTCTCCTGGGCAGG + Intronic
1076625970 10:131822284-131822306 CTGCTGACTGTCTGTGGGGGTGG - Intergenic
1076867880 10:133177069-133177091 CTGCTCACCCTCTTCTGCTGGGG + Intronic
1077015598 11:397798-397820 CTGCTCTTCCTCTGCTGAGGGGG - Intronic
1077018168 11:406134-406156 CTGCTCACCCCCTGCTGTGATGG + Intronic
1077333991 11:1995215-1995237 CTGCTGAAGCCCTGGTGGGGAGG + Intergenic
1077334468 11:1997287-1997309 ATCCTGCCCCTCTGCTGGGAGGG + Intergenic
1077335626 11:2002564-2002586 CGGGTGAACCTCAGCTGGGGCGG + Intergenic
1077696007 11:4393449-4393471 GTGCTGGCCCCCTGCTTGGGAGG - Intronic
1079217498 11:18526840-18526862 CGGCTGACCCTCTGCCTGCGGGG - Exonic
1081177600 11:39947560-39947582 GTTCTGAACCCCTGCTGGGGAGG - Intergenic
1081831583 11:46120336-46120358 CGGCTGTCCCTCGGCCGGGGAGG - Intronic
1081976615 11:47239426-47239448 CTGCTCTCCCTCAGCTGGGCTGG - Exonic
1084361316 11:68670131-68670153 CTGCTGAACCTCTTCCTGGGAGG - Intergenic
1084690362 11:70721641-70721663 GTGCTGTCCCAGTGCTGGGGAGG + Intronic
1084789398 11:71463797-71463819 CTGGTCACCAGCTGCTGGGGAGG + Intronic
1085516133 11:77112956-77112978 CAGCTGAGCCTGTGCTGGGTGGG + Intronic
1085883569 11:80496559-80496581 GTGCTGACCTAGTGCTGGGGTGG + Intergenic
1088585720 11:111358802-111358824 GTGCTGCCCCACTGCTGGCGTGG + Exonic
1088881296 11:113975422-113975444 TGGCTGACCATCTGCTGAGGTGG + Intronic
1089393464 11:118117772-118117794 CTCCTGGCCCTCTGCAGGGTAGG + Intronic
1091097790 11:132840380-132840402 CAGCTGCCCCTTTGCTGAGGTGG + Intronic
1202816974 11_KI270721v1_random:50397-50419 CTGCTGAAGCCCTGGTGGGGAGG + Intergenic
1202817451 11_KI270721v1_random:52469-52491 ATCCTGCCCCTCTGCTGGGAGGG + Intergenic
1202818610 11_KI270721v1_random:57746-57768 CGGGTGAACCTCAGCTGGGGCGG + Intergenic
1091394078 12:142921-142943 CTGCTGTCTCTCTGCTCTGGGGG + Intronic
1091612722 12:2024876-2024898 GTGCAGACCCTCAGCTGGTGTGG + Intronic
1091746395 12:2995556-2995578 CTGGTGACCCTCTGCTGGGTTGG - Intronic
1091813925 12:3421919-3421941 CTGCTGGCCTGCTACTGGGGTGG + Intronic
1091916221 12:4273132-4273154 CTGCACACACTCTGCAGGGGGGG + Intergenic
1091970143 12:4779953-4779975 CTGCTCACCCTCAGATGGGAGGG + Intronic
1092182115 12:6453070-6453092 CCACTGCCCCTCTGCTGGGTGGG - Exonic
1092659635 12:10723582-10723604 CTGCTGACCCTTTGTTGGAGCGG + Intergenic
1093547984 12:20369771-20369793 CTGCTGGCCGCCTGCTGCGGGGG + Exonic
1093978887 12:25453146-25453168 CTGCTGCCCCCAGGCTGGGGAGG + Intronic
1096623447 12:52878956-52878978 AAGCTCACCGTCTGCTGGGGAGG + Intergenic
1098188323 12:67922095-67922117 CTGCTGACATTGTGCTGGTGTGG - Intergenic
1098461438 12:70736991-70737013 CTCCTGCCCCACTGCTGGGAGGG + Intronic
1099860402 12:88218608-88218630 CTGCTGCCCCTAAGCTTGGGAGG + Intergenic
1100420679 12:94429937-94429959 CTGCAGCCCTACTGCTGGGGAGG - Intronic
1103606299 12:122088190-122088212 CTGCTGTCCCTCTCCAGGGGAGG + Intronic
1103726513 12:122999882-122999904 CTTCTGCCCCTCCCCTGGGGGGG + Intronic
1103902073 12:124308578-124308600 CTGCAGACCCTCTCCCTGGGAGG - Intronic
1104019258 12:124980744-124980766 CCGCTGGCCCTCAGCTGAGGAGG - Exonic
1104660488 12:130608483-130608505 CTGGTGTCTCTCTACTGGGGAGG + Intronic
1105880936 13:24606442-24606464 CTGCTGTCCCTAAGCTGAGGAGG - Intergenic
1106627355 13:31434312-31434334 CTGCTGACCCTTCGCTGAGCTGG - Intergenic
1107430270 13:40334230-40334252 CTGCCCCACCTCTGCTGGGGTGG - Intergenic
1112166674 13:96927265-96927287 CTGATGGCCATCAGCTGGGGTGG + Intergenic
1113571408 13:111360944-111360966 CTGGGGTCCCTCTGCTGGGGAGG + Intergenic
1113728362 13:112622544-112622566 TGCCAGACCCTCTGCTGGGGTGG + Intergenic
1113728380 13:112622600-112622622 CCCCAGGCCCTCTGCTGGGGTGG + Intergenic
1117234832 14:53761739-53761761 CTGTTGACTCTCTGCTGTGGTGG - Intergenic
1117993954 14:61461165-61461187 CTGCTTTCCCTCTGCTGGATTGG + Intronic
1118568884 14:67172851-67172873 CTGCAGACCCTGTGCTGGTGGGG - Intronic
1119665073 14:76479645-76479667 CTGCCTACACTCTGCTGGGGAGG + Intronic
1123825916 15:24081948-24081970 CTGCTGGGCCTCTGATGGGATGG + Intergenic
1123998348 15:25734183-25734205 GTGACGGCCCTCTGCTGGGGTGG - Intronic
1124802032 15:32842310-32842332 CTGCAGAGCCTCGGCTCGGGTGG - Intronic
1127097401 15:55526840-55526862 CTGCTGCCCCCAAGCTGGGGAGG - Intergenic
1128558291 15:68646520-68646542 CAGCTGCCCCTCTGATGGAGAGG - Intronic
1129193060 15:73948613-73948635 CTGCTGACTTTCTGCAGGGAAGG - Intronic
1129597267 15:76974680-76974702 GGGCTGACCCTCTGATGGGGTGG + Intergenic
1131091616 15:89628536-89628558 CGGCTGAGCCCCTGGTGGGGCGG - Exonic
1131587014 15:93706355-93706377 CTCCTGAGCCTCTGCTTGGCTGG - Intergenic
1131868253 15:96734435-96734457 GTTCTGAGCTTCTGCTGGGGAGG + Intergenic
1132099990 15:99015886-99015908 CGGCTGAGCTGCTGCTGGGGAGG - Intergenic
1132544245 16:526032-526054 CAGCTGCCTCTCTGGTGGGGAGG + Intergenic
1132558295 16:582342-582364 CTGCTGCCCCTGTTCTGGGACGG + Intronic
1132597565 16:760384-760406 CTGCTGACCTGCGACTGGGGGGG + Intronic
1132850752 16:2023880-2023902 CTGCTCTCCCTCTGCTGGATAGG + Intergenic
1135881325 16:26260340-26260362 TTGCTGTGGCTCTGCTGGGGTGG + Intergenic
1136230457 16:28882757-28882779 CTGCTGAGACTCCGCTGGGGAGG - Intronic
1137546960 16:49411218-49411240 CCCCTGACTCTCAGCTGGGGTGG - Intergenic
1137719415 16:50619201-50619223 CTTCTTTCCCTCTGCTTGGGAGG + Intronic
1139488293 16:67271615-67271637 CCACTGACCCAGTGCTGGGGAGG - Exonic
1140454469 16:75096948-75096970 GTGCTGAGCCCCTGCTGGAGGGG + Intronic
1141609953 16:85175627-85175649 CTGCTGCCTTTCTGCTGGGATGG + Intronic
1141919425 16:87126088-87126110 CAGCTGCCCCTCTGCCGAGGAGG + Intronic
1142010352 16:87710820-87710842 CTGCTGTGCCTGTGCTGGGCTGG + Intronic
1142147835 16:88499888-88499910 CCGCTCACCCTCTGCTGGCATGG - Intronic
1142210085 16:88804618-88804640 CGGCTGACCTGCTGCCGGGGTGG - Exonic
1142573736 17:892606-892628 CTGCTGACACTTTGCTGGGAAGG + Intronic
1143103261 17:4515403-4515425 CTGCTGCCCATAGGCTGGGGGGG + Intronic
1143483654 17:7240829-7240851 CTGCTGCCCCTGAGCTGGAGGGG - Exonic
1145272030 17:21409924-21409946 CAGCTGAGTCTCTGGTGGGGAGG + Intronic
1146923393 17:36728454-36728476 CTGCTGTTCCTCTTCTGGTGAGG - Intergenic
1147564259 17:41527200-41527222 TTGGTAAACCTCTGCTGGGGAGG - Intronic
1147706648 17:42429948-42429970 CTGCTTTCCCTATGCTGGGGGGG - Intergenic
1148246317 17:46033080-46033102 CTGCTGCCCCGCCGCTGGGGTGG + Exonic
1148911344 17:50944666-50944688 CTCCTGACCTTAAGCTGGGGCGG + Intergenic
1149010657 17:51853375-51853397 CTGCTGTCCCTGTGCTGGTCAGG + Intronic
1150817155 17:68401368-68401390 CAGCTGCCCCGCTGTTGGGGTGG - Exonic
1151369566 17:73639400-73639422 CTGCTGTCCATGTGCTGGGCAGG - Intronic
1152209260 17:78994397-78994419 CTGCTGGCCCTATGTTGGTGTGG + Intronic
1154026381 18:10710769-10710791 CTGCAGAACCTCTTCTAGGGAGG + Intronic
1154162266 18:11989502-11989524 CAGCTGTCCCTTTGGTGGGGTGG + Intronic
1157835557 18:50899010-50899032 CTGCTCACCTTCTGCTGTGTGGG - Intronic
1158735593 18:60075499-60075521 CTGCTGCCCTGCTGCTGGAGAGG - Intergenic
1160157378 18:76443931-76443953 CTCCTCACCCTCTGGTGGGTGGG - Intronic
1160808536 19:1003050-1003072 CGGATCACCCGCTGCTGGGGTGG + Intronic
1160989333 19:1854130-1854152 CTGCTGCCCCCCTCCCGGGGTGG - Exonic
1161856713 19:6769922-6769944 CTGCTTACACTCTACTGGGGTGG + Intergenic
1162401008 19:10446528-10446550 CTGCTTACCCTTCACTGGGGAGG - Intronic
1162736025 19:12747602-12747624 CTGCTGAGCCAGTGCTGGGTGGG - Intronic
1163162945 19:15476289-15476311 CTGTGGAGCCTCTGCTGGCGGGG - Exonic
1163633175 19:18427232-18427254 CTGCTGAGCAGCTGGTGGGGAGG + Intronic
1164084167 19:21886673-21886695 CTGCTGAGCCTGTGGTGGTGGGG + Intergenic
1164493348 19:28735293-28735315 GTGCTCACCCTCAGCAGGGGTGG + Intergenic
1165988603 19:39792504-39792526 CTGCTCACCTCCTGCTGTGGCGG + Intergenic
1167272156 19:48511681-48511703 CTCCTGCCCCTCTCCTGGGCCGG - Intronic
1168245939 19:55113260-55113282 CTGCAGAGTATCTGCTGGGGTGG - Intronic
1168504906 19:56925443-56925465 CTGATCACGCTTTGCTGGGGGGG - Intergenic
925175331 2:1779484-1779506 CTGGTGAGGCTCTGCTGGTGAGG - Intergenic
925175333 2:1779498-1779520 CTGGTGAGGCTCTGCTGGTGAGG - Intergenic
925175338 2:1779540-1779562 CTGGTGAGGCTCTGCTGGTGAGG - Intergenic
925175342 2:1779568-1779590 CTGGTGATGCTCTGCTGGTGAGG - Intergenic
925175346 2:1779610-1779632 CTGGTGAGGCTCTGCTGGTGAGG - Intergenic
925175352 2:1779652-1779674 CTGGTGATGCTCTGCTGGTGAGG - Intergenic
925175356 2:1779694-1779716 CTGGTGAGGCTCTGCTGGTGAGG - Intergenic
925175358 2:1779708-1779730 CTGGTGAGGCTCTGCTGGTGAGG - Intergenic
925175360 2:1779722-1779744 CTGGTGAGTCTCTGCTGGTGAGG - Intergenic
925175363 2:1779750-1779772 CTGGTGAGTCTCTGCTGGTGAGG - Intergenic
925175376 2:1779890-1779912 CTGCTGAGGCTCTGCTGGTGAGG - Intergenic
925175380 2:1779932-1779954 CTGGTGATGCTCTGCTGGTGAGG - Intergenic
925175383 2:1779960-1779982 CTGGTGATGCTCTGCTGGTGAGG - Intergenic
925175386 2:1779988-1780010 CTGGTGAGTCTCTGCTGGTGAGG - Intergenic
925175399 2:1780128-1780150 CTGGTGATGCTCTGCTGGTGAGG - Intergenic
925175418 2:1780310-1780332 CTGGTGAGGCTCTGCTGGTGAGG - Intergenic
925175420 2:1780324-1780346 CTGGTGAGTCTCTGCTGGTGAGG - Intergenic
925175425 2:1780380-1780402 CTGGTGAGGCTCTGCTGGTGAGG - Intergenic
925175427 2:1780394-1780416 CTGGTGAGTCTCTGCTGGTGAGG - Intergenic
925175433 2:1780450-1780472 CTGGTGATGCTCTGCTGGTGAGG - Intergenic
925175437 2:1780492-1780514 CTGGTGAGTCTCTGCTGGTGAGG - Intergenic
925175441 2:1780534-1780556 CTGGTGAGGCTCTGCTGGTGAGG - Intergenic
925175448 2:1780590-1780612 CTGGTGATGCTCTGCTGGTGAGG - Intergenic
925175452 2:1780632-1780654 CTGGTGAGTCTCTGCTGGTGAGG - Intergenic
925175458 2:1780702-1780724 CTGGTGAGTCTCTGCTGGTGAGG - Intergenic
925175462 2:1780744-1780766 CTGGTGAGTCTCTGCTGGTGAGG - Intergenic
925175472 2:1780828-1780850 CTGGTGAGCCTCTGCTGGTGAGG - Intergenic
925370115 2:3338522-3338544 CTGCTGCACAGCTGCTGGGGAGG + Intronic
927757129 2:25717931-25717953 GTGCTGACATTCTGTTGGGGGGG - Intergenic
928595751 2:32857430-32857452 GTGCTCACCCTCTGGGGGGGTGG - Intergenic
930429129 2:51251505-51251527 CAGCTGCCCCTCTGCTCAGGGGG - Intergenic
932460041 2:71876143-71876165 CTCCTGTCCCTCTGCTGCAGAGG + Intergenic
934220360 2:90076562-90076584 ATGCTGACCCTAAGCTGTGGAGG - Intergenic
934747830 2:96771038-96771060 CGGCTGGCCCTCGGCTGAGGGGG + Intronic
934762515 2:96864432-96864454 CTGCTTGCCCTTAGCTGGGGTGG - Intronic
935025241 2:99270277-99270299 CTACTCACCCTCTGCTGAGGTGG + Intronic
935384573 2:102487031-102487053 CTTCTGACCTTCTGTTGGGGAGG + Intronic
935827258 2:106964073-106964095 CTCCTGACCCTCGGGTGGGCTGG + Intergenic
936502078 2:113074481-113074503 CTGCTGACCCTCTGCTGGGGAGG - Intronic
937126652 2:119478868-119478890 CTGCTGGCCCTCTTCTGTGCCGG - Exonic
937463648 2:122110590-122110612 CTGCTGACCCTGTCATGGGCTGG - Intergenic
938639634 2:133265934-133265956 GCGCTGGCCCTCTGCTTGGGAGG + Intronic
939275311 2:139991384-139991406 CTGCTGCCCCCAAGCTGGGGAGG - Intergenic
940581473 2:155585155-155585177 CTGCTGCCCCCAAGCTGGGGAGG + Intergenic
941843250 2:170109839-170109861 ATGCTGAGCTCCTGCTGGGGAGG + Intergenic
944906291 2:204265190-204265212 CTGGTAACCCACAGCTGGGGTGG - Intergenic
945866531 2:215182422-215182444 CTGCAGCCCTGCTGCTGGGGAGG + Intergenic
946968970 2:225070663-225070685 ATGCTGCCCCTTTGCTGGGAGGG - Intergenic
948404689 2:237708477-237708499 CTGCTGACCCTGTACTGGGAAGG + Intronic
948627101 2:239275990-239276012 ATGCTGGCCATCTGCTTGGGCGG - Intronic
948877447 2:240837193-240837215 CTGCTCACCCTTAGCTGAGGAGG + Intergenic
1168804022 20:662398-662420 TTGCTGACCCTCAACTGGGGGGG - Exonic
1169144684 20:3244636-3244658 TTGTTGACCCTCTGCAGGGCAGG - Intergenic
1171249295 20:23636460-23636482 CAGCTGAGTCCCTGCTGGGGTGG - Intronic
1171266401 20:23775423-23775445 CTGCTGAGTTCCTGCTGGGGTGG - Intergenic
1171272199 20:23826012-23826034 CAGCTGAGTCCCTGCTGGGGTGG - Intronic
1174388455 20:50200991-50201013 TGGCTGACCCTCTTGTGGGGTGG + Intergenic
1175428356 20:58885248-58885270 TTCCTGACTCTCTGATGGGGAGG - Intronic
1175507458 20:59495923-59495945 CTGGTGACCCTCTGTGGTGGGGG - Intergenic
1175959216 20:62626537-62626559 CTGGTGCCCCTCTGCCTGGGAGG - Intergenic
1175960337 20:62633067-62633089 CAGCAATCCCTCTGCTGGGGAGG + Intergenic
1176120491 20:63452438-63452460 CTAGTGACCCTCTGCCGTGGGGG - Intronic
1179566103 21:42250215-42250237 GTGTTGACCTTCTCCTGGGGTGG + Intronic
1179599158 21:42464472-42464494 CTGCTGGCCCTGGGGTGGGGAGG - Intergenic
1179623103 21:42631827-42631849 CTGCTGACAGTCTGCTAGGCTGG - Intergenic
1180141233 21:45894340-45894362 CTGCTGTCCCTCTGATGGGGAGG + Intronic
1180590473 22:16932966-16932988 CTGCTGATGCTCTGCTTGGAGGG - Intergenic
1181178614 22:21052152-21052174 GTGCCGAGCCTCTGCTGGGCAGG - Intronic
1182125152 22:27810708-27810730 CGGCTAAGCCTCAGCTGGGGTGG - Intergenic
1182127301 22:27825349-27825371 CTGCTGGCACTCTGCTGCGCAGG + Intergenic
1182295803 22:29310835-29310857 GTGCAGACCCTCGGCTGGGGTGG - Exonic
1182539711 22:31032205-31032227 CTGAGGACCTTCTGGTGGGGTGG + Intergenic
1182667825 22:31972216-31972238 ATGCTGACCCGCTCCTGAGGTGG + Intergenic
1182824784 22:33255399-33255421 CTGCTGACCAAATGCTGGAGAGG + Intronic
1182899380 22:33885302-33885324 TAGCTGACCCTCTGCGGAGGGGG + Intronic
1183498291 22:38163000-38163022 CTGCTGTGTCTCTGCTGGGGTGG + Intronic
1183515936 22:38266107-38266129 CTGCACCCCCTCTGTTGGGGAGG + Intronic
1183931691 22:41239165-41239187 CTGCAGACCCTGTGGTGGAGAGG - Intronic
1184599011 22:45531757-45531779 CTGGTGAGGCCCTGCTGGGGAGG + Intronic
1184629266 22:45763162-45763184 CTGGTGACTCTCAGTTGGGGAGG + Intronic
1185203839 22:49525446-49525468 CTGCATACCATGTGCTGGGGAGG + Intronic
1185397736 22:50601170-50601192 GGGCCGACCCTCTGCGGGGGAGG + Intronic
952616133 3:35276297-35276319 ATGCTGCCCCTCTGTTGTGGGGG - Intergenic
953369145 3:42372608-42372630 TTCCTCACCCTTTGCTGGGGGGG - Intergenic
954214391 3:49116346-49116368 CTGCTGTGCCTCTGCAGGGATGG - Exonic
954446865 3:50551520-50551542 CTGCTGGGCCTCAGCTGGGGAGG + Intergenic
954502200 3:51029335-51029357 TTGCTCACCCTCTGCGGGGCTGG + Intronic
954876587 3:53806404-53806426 CTGCTTTCCCTCTGCAGCGGTGG + Intronic
954959288 3:54550254-54550276 CTGCATCCCCTCTGCTGAGGGGG + Intronic
955922570 3:63973284-63973306 GTCCTGAGCCTCTGCTGGGAAGG + Intronic
957868217 3:86051645-86051667 CTGCTGGACTTCTGCAGGGGAGG + Intronic
960263044 3:115589927-115589949 CTGCTTACCCTGGGCTGGCGGGG - Intergenic
961627451 3:128273837-128273859 GTGCTGCCCCACTGCTGAGGTGG + Intronic
964505189 3:157391350-157391372 CTGCTCTCCCTCAGCTTGGGTGG - Intronic
964758872 3:160114799-160114821 CTGCAGATCCTCTTCTGGGCGGG - Intergenic
967377837 3:188825642-188825664 GTGGTGACCCTGGGCTGGGGAGG - Intronic
968690694 4:1988339-1988361 CTGCTGACCCTCAGCGAGGACGG - Intronic
969418405 4:7075742-7075764 CTGCTGATCCTCCACTGAGGAGG - Intergenic
969601228 4:8177721-8177743 CTCCTGACTCCCTGCTGGGCTGG + Intergenic
975762360 4:77632360-77632382 CTGCAGACCCTCCCCTGAGGGGG + Intergenic
977926452 4:102705625-102705647 CTGCTGCCCTGCTCCTGGGGAGG - Intronic
978675487 4:111309701-111309723 CTGCTCACTCTGTGCTGGGTAGG + Intergenic
981545336 4:145887595-145887617 AGGCTTTCCCTCTGCTGGGGTGG + Intronic
982018655 4:151181378-151181400 CAGGTGAACCTCTGCTGGGTTGG + Intronic
982107302 4:152022211-152022233 CTGCTGACCCTCTGCCAAGCGGG - Intergenic
984617905 4:181919352-181919374 CTGCTTTGCTTCTGCTGGGGAGG - Intergenic
985541449 5:489358-489380 CTGCTGCCTCTCTGCTGGGCTGG + Intronic
985651099 5:1107961-1107983 CGCGTGACCCTCTGCTGTGGAGG + Intronic
986667562 5:10116695-10116717 CTGCTGCCCTCCTGCTGGTGTGG + Intergenic
987162099 5:15155215-15155237 CTGCCTAGCCTCTGCTGAGGGGG + Intergenic
989107733 5:37879354-37879376 CTTCTGCCCCTCTGCTCTGGGGG + Intergenic
991733288 5:69609311-69609333 CTGCAGAACCACTGCTGGGTTGG + Intergenic
991809723 5:70464457-70464479 CTGCAGAACCACTGCTGGGTTGG + Intergenic
991861665 5:71018540-71018562 CTGCAGAACCACTGCTGGGTTGG - Intronic
992003914 5:72460139-72460161 CTGCGGGGCCTCTGGTGGGGCGG - Intronic
997092227 5:130871265-130871287 CTCCTGACTTCCTGCTGGGGAGG + Intergenic
997566093 5:134887734-134887756 CTGCTCACCCTCTCCAGGTGGGG + Exonic
997608704 5:135195180-135195202 CTTCTGACCCTCTGCCAGGATGG - Intronic
997886683 5:137636822-137636844 CTGATGACTCTCTGCAGGGCAGG - Intronic
997955490 5:138275500-138275522 CTGCTGGCCCTCTGCCAGGCTGG - Intergenic
998573609 5:143288980-143289002 CTGCAATCCCACTGCTGGGGAGG + Intronic
1001105688 5:168852179-168852201 CTCCTGCGCCTCTGCCGGGGAGG - Intronic
1001315970 5:170641558-170641580 CTCTCAACCCTCTGCTGGGGTGG + Intronic
1001741112 5:174053415-174053437 CTGATGATGCTCTGCAGGGGAGG + Intronic
1002811181 6:631076-631098 CTTCTGATCCTCGCCTGGGGAGG - Intronic
1002846169 6:947348-947370 GTGCTGACCCTGGGCTGGAGGGG + Intergenic
1003171656 6:3725539-3725561 CTGCTGAGACTCTGCTGTGGGGG + Intronic
1005882418 6:30071467-30071489 CTGCAGAGACTCTTCTGGGGAGG - Exonic
1005883037 6:30074777-30074799 CTCCTCACCCTCAGCTGGGTCGG + Intronic
1006211812 6:32401718-32401740 CTCCCCTCCCTCTGCTGGGGAGG + Intronic
1006368940 6:33632771-33632793 CTCCTGAGCCTCTGCTGGGCTGG + Intronic
1006474093 6:34244154-34244176 GAGCTGAGCCACTGCTGGGGTGG + Intronic
1006908394 6:37548171-37548193 CTTCTGCCCCTCTCCTGGAGGGG + Intergenic
1008535238 6:52502441-52502463 CTGCTGTCGCTCTGTGGGGGGGG - Exonic
1016735069 6:147469343-147469365 CTGCTGTCGCTCTGGTGGAGAGG + Intergenic
1018793495 6:167168632-167168654 CTCCTGAGCCTCAGCCGGGGTGG - Intronic
1018823220 6:167389746-167389768 CTCCTGAGCCTCAGCCGGGGTGG + Intergenic
1019905176 7:4057113-4057135 CTGCGGCCCTGCTGCTGGGGAGG - Intronic
1022092972 7:27119711-27119733 CTTCTGTTCCTCTGCAGGGGAGG - Intronic
1022754348 7:33269507-33269529 CTGCTGCCTCTAAGCTGGGGAGG + Intronic
1025253155 7:57365474-57365496 CTGCCCACCCACTGGTGGGGAGG - Intergenic
1027166142 7:75835642-75835664 CTGCTGGTCCACAGCTGGGGAGG - Intergenic
1028432809 7:90767111-90767133 CTGCTGACACTGTGCATGGGGGG - Intronic
1030568190 7:111187308-111187330 CTGGTGGCCCTCTCCTTGGGTGG - Intronic
1031960715 7:127987219-127987241 CTGCTGATGCTCAGCTGGGCAGG - Intronic
1032266512 7:130373801-130373823 CTGTTGACTCTGTGCTGGTGTGG - Intergenic
1034233568 7:149551295-149551317 ATGCTGAGACTCTGCTTGGGGGG + Intergenic
1034667115 7:152828172-152828194 CTGCGGACCCTCTTCAGGCGGGG + Intronic
1035300631 7:157895052-157895074 CTGCTGACCCCCTCCTGTGGGGG - Intronic
1035445750 7:158941976-158941998 CTGCTGTCCCACTGCAGGAGCGG - Exonic
1036119666 8:6002090-6002112 TTCCTGGCCCTGTGCTGGGGGGG + Intergenic
1036215916 8:6879633-6879655 GTGCTGACCGCCTCCTGGGGAGG + Intergenic
1037663355 8:20945268-20945290 CTTCTGCCCATCTGCTGTGGAGG - Intergenic
1038319709 8:26514936-26514958 GGGCTGATCCCCTGCTGGGGCGG + Intronic
1039443436 8:37611519-37611541 CTGCTGACTTGCTGCTGGGCAGG + Intergenic
1039793333 8:40892382-40892404 CTGCTGACCCATCCCTGGGGGGG - Intronic
1039881681 8:41629168-41629190 CTGCTCAGCCTCTGCAGGAGAGG + Intergenic
1040985974 8:53294745-53294767 CTGCAGAGCCCCTGCTGGGGTGG + Intergenic
1041024035 8:53666038-53666060 CTGCTGCCCCACACCTGGGGAGG - Intergenic
1041151943 8:54944214-54944236 CTGCTTCCCCTCTTGTGGGGTGG + Intergenic
1041296038 8:56358560-56358582 CTGCTGGCCCCAAGCTGGGGAGG - Intergenic
1043703717 8:83322724-83322746 CTGTTGATCCCCTGCTGGTGAGG - Intergenic
1044699379 8:94952045-94952067 AGGCTGACCCCCTGCTGTGGGGG + Intronic
1045417920 8:101985303-101985325 CTGCATACCATCAGCTGGGGTGG - Intronic
1045510196 8:102807340-102807362 ATGCCGACCCTCTCCGGGGGAGG + Intergenic
1047782865 8:128123980-128124002 CTGCTCCCCCACTGGTGGGGAGG - Intergenic
1048451616 8:134538365-134538387 CTGCTGAACCTCTTCTTGGTAGG - Intronic
1048723763 8:137358460-137358482 CTGCTCACCTTCTGCTGTGCGGG - Intergenic
1048988849 8:139749795-139749817 CTGCTGCCCCTGTGCTGGACTGG + Intronic
1049065899 8:140313707-140313729 ATGCTAATCTTCTGCTGGGGTGG + Intronic
1049178495 8:141208311-141208333 CGGCTCTCCCACTGCTGGGGCGG - Intronic
1049688844 8:143950025-143950047 CCCCTGACCCTCGGCTAGGGGGG + Intronic
1049814744 8:144592929-144592951 ATGCTGACCCTCTGTGGTGGAGG - Intronic
1053391691 9:37740726-37740748 CTGCTGACCCCAGGCTGGCGGGG - Exonic
1057198321 9:93127254-93127276 CTGTTGAGCCTCTGCTGTGTCGG - Intronic
1057308315 9:93925265-93925287 ATGCCCACCCTCTGCTGGTGGGG - Intergenic
1057369109 9:94453791-94453813 CTGATGACCTTCTACAGGGGTGG - Intronic
1060748109 9:126151030-126151052 GTGCCCACCCTCTCCTGGGGAGG + Intergenic
1061368038 9:130182645-130182667 CTGCTGAGCCTCCACTGGGGTGG - Intronic
1062146500 9:134992405-134992427 CGGGAGACCCTCTGCCGGGGCGG - Intergenic
1062555481 9:137111875-137111897 CTGCTGACCAGCTTCTGGGGGGG - Exonic
1187127670 X:16469299-16469321 CTCCTCCCCCTCTGCTTGGGTGG - Intergenic
1188757932 X:33987343-33987365 CTGCAGCCCTGCTGCTGGGGAGG + Intergenic
1189179116 X:38986776-38986798 CTGCAGCCCCTCTGGTGGTGGGG + Intergenic
1190448616 X:50555918-50555940 CTGCTGACTGTCTGCAGGAGGGG + Intergenic
1190793396 X:53720694-53720716 CTGCAGTCCCACTGCTTGGGAGG - Intergenic
1195429379 X:104771256-104771278 GTGCTGATACTCTGCTGGAGGGG - Intronic
1197804349 X:130384930-130384952 GTGCTGACCCTCTCCTGCGTTGG - Exonic
1198579308 X:138046322-138046344 CTGTTTACCCTGTGCTGGCGAGG - Intergenic
1198583690 X:138096190-138096212 CTGCTGCCCCGCCACTGGGGAGG - Intergenic
1200092719 X:153643404-153643426 CTGCTGAGCCTCTGCCGAAGGGG - Intronic