ID: 936502134

View in Genome Browser
Species Human (GRCh38)
Location 2:113074762-113074784
Sequence CCCCAGGAAAATGGGGACCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 282}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
936502134_936502150 24 Left 936502134 2:113074762-113074784 CCAAGGTCCCCATTTTCCTGGGG 0: 1
1: 0
2: 2
3: 29
4: 282
Right 936502150 2:113074809-113074831 GCATGTGTGGAGACAGAAGAGGG 0: 1
1: 0
2: 2
3: 36
4: 420
936502134_936502146 11 Left 936502134 2:113074762-113074784 CCAAGGTCCCCATTTTCCTGGGG 0: 1
1: 0
2: 2
3: 29
4: 282
Right 936502146 2:113074796-113074818 GAGCCGCTGCCTGGCATGTGTGG 0: 1
1: 0
2: 3
3: 14
4: 183
936502134_936502145 2 Left 936502134 2:113074762-113074784 CCAAGGTCCCCATTTTCCTGGGG 0: 1
1: 0
2: 2
3: 29
4: 282
Right 936502145 2:113074787-113074809 CCAGGGAGGGAGCCGCTGCCTGG 0: 1
1: 0
2: 3
3: 39
4: 484
936502134_936502151 25 Left 936502134 2:113074762-113074784 CCAAGGTCCCCATTTTCCTGGGG 0: 1
1: 0
2: 2
3: 29
4: 282
Right 936502151 2:113074810-113074832 CATGTGTGGAGACAGAAGAGGGG 0: 1
1: 0
2: 3
3: 38
4: 418
936502134_936502149 23 Left 936502134 2:113074762-113074784 CCAAGGTCCCCATTTTCCTGGGG 0: 1
1: 0
2: 2
3: 29
4: 282
Right 936502149 2:113074808-113074830 GGCATGTGTGGAGACAGAAGAGG 0: 1
1: 0
2: 5
3: 30
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
936502134 Original CRISPR CCCCAGGAAAATGGGGACCT TGG (reversed) Exonic
900581450 1:3411831-3411853 CCCCAGGGGACTGGGGAGCTTGG - Exonic
900850963 1:5142771-5142793 ACCCAGGAATTTGGGGAGCTGGG + Intergenic
901302709 1:8211223-8211245 CTCCCAGAAAATGGGGAGCTTGG + Intergenic
902869221 1:19303471-19303493 TCCAAGGGAAATGAGGACCTTGG + Intergenic
902988257 1:20168903-20168925 CACCAGGCAAATTGGGCCCTGGG + Intronic
903669763 1:25028470-25028492 CCCCAGGAAAGATGGGAGCTGGG + Intergenic
905265591 1:36752570-36752592 CCCCAGGACAAAGGAGACCCAGG + Intergenic
906702752 1:47871831-47871853 CACCAGCAACATGGGGATCTTGG + Intronic
908386014 1:63642606-63642628 CCTCAGGAAAATAGGGGGCTTGG + Intronic
908416141 1:63915218-63915240 GCCCAGAAAAATGGTGACATGGG - Intronic
910054863 1:83021411-83021433 CCCAAGGAATAGGGAGACCTGGG + Intergenic
911691188 1:100836543-100836565 CCCAAGGAAAATGGGAATTTTGG + Intergenic
911764138 1:101653946-101653968 CCCCAAGATGATGGGGAACTTGG + Intergenic
913074775 1:115332741-115332763 CTCCAGGAAAGTGGAGACATAGG - Intronic
915218005 1:154352711-154352733 CACTAGGACGATGGGGACCTAGG - Intergenic
918394730 1:184101952-184101974 CCCCAGAAAGATGGTTACCTTGG + Intergenic
918697656 1:187563605-187563627 CCCCAGGGCAATGTGGATCTTGG + Intergenic
919938499 1:202270797-202270819 TCCCAGGGAGATGGGGACATAGG - Intronic
920071487 1:203305890-203305912 ACCCAGGAAACTGGGGACTGCGG - Intronic
920811719 1:209292068-209292090 CCCCATGAAAATGGAGACCAAGG + Intergenic
920972645 1:210755772-210755794 CCCTAGGAAAGTGGGGATCTGGG - Intronic
921475152 1:215597861-215597883 CCCCAACAAAATGTGGGCCTAGG - Intronic
922847288 1:228696992-228697014 CACCAGGAATATGTAGACCTCGG - Intergenic
1064061978 10:12145914-12145936 CCCCAGGAAGAAGGGGAGCAAGG + Intronic
1068587520 10:58816039-58816061 GCCCAGGAAAATGGAAACATTGG - Intronic
1069782526 10:70965755-70965777 CCACATGAAAATGGGGAGCCTGG - Intergenic
1071986683 10:91058630-91058652 TCCTAGGAAAATGGGAACCTTGG + Intergenic
1072798484 10:98374996-98375018 ACCGAGGCAGATGGGGACCTGGG - Intergenic
1072893027 10:99341746-99341768 TTCCAGCAAAATGGGGAGCTAGG + Intronic
1073243464 10:102073287-102073309 ACCCAGAAGAAAGGGGACCTGGG + Intergenic
1073466396 10:103696842-103696864 TCCCAGGAAAACAGGGACATGGG + Intronic
1073859886 10:107725924-107725946 CCTCCTGAAAATGGTGACCTGGG - Intergenic
1074232652 10:111553275-111553297 TTCCAGAAAGATGGGGACCTGGG + Intergenic
1075898579 10:126019715-126019737 CCCCAGGACAATGGGAGACTGGG - Exonic
1075993888 10:126860861-126860883 GCCCAGGAAAAAGGGGACAGTGG - Intergenic
1077146730 11:1049873-1049895 CTGTAGGAAAATGGGGACGTCGG + Intergenic
1078822562 11:14896419-14896441 CCCCAGGAACACAGGGACCATGG - Intergenic
1082175642 11:49055884-49055906 CCTCAGGAAAATGGTTGCCTCGG - Intronic
1082295926 11:50441190-50441212 CACCAGGAAAATGGGGAGCAGGG + Intergenic
1083000941 11:59290031-59290053 CCCCAGGCAAATGGGAAACCGGG - Intergenic
1083194863 11:61079857-61079879 TCCCAGGTGTATGGGGACCTGGG - Intergenic
1083545630 11:63547064-63547086 GCACAGAAACATGGGGACCTGGG - Intergenic
1083606455 11:63981758-63981780 CAGCAAGAACATGGGGACCTTGG + Intronic
1084384094 11:68831375-68831397 CCCAAGGAAAATGGAGATATGGG + Intronic
1085127451 11:74011318-74011340 CCCAAGGGAAGTGGGGCCCTGGG + Intergenic
1086690105 11:89780185-89780207 CCTCAGGAAAATGGTTACCTCGG + Intergenic
1086715749 11:90059772-90059794 CCTCAGGAAAATGGTTACCTCGG - Intergenic
1087689260 11:101300614-101300636 CCCCAGGAAGAATGTGACCTAGG + Intergenic
1087808504 11:102582908-102582930 GCCCAGGAAGATGGGGTCCAAGG - Intronic
1088192624 11:107242248-107242270 GCCCAGGAACATGGAGCCCTGGG - Intergenic
1088528731 11:110785603-110785625 ACACAGGACAATGGGGCCCTGGG - Intergenic
1089560838 11:119342377-119342399 CCCAAGGGAAATGGGAATCTGGG - Intronic
1091663075 12:2398967-2398989 CCCCAGGAACATGGGGCTTTGGG + Intronic
1091930899 12:4394522-4394544 GCACAGGAAACTGGAGACCTGGG - Intergenic
1091974066 12:4810758-4810780 CCCTGGGGAAATGGGGACCGGGG + Exonic
1092118384 12:6025829-6025851 CCCCATGACAATGGGGACAGAGG + Intronic
1098851860 12:75605257-75605279 CCCCAGTAAGCTGGGGACCCAGG - Intergenic
1100870591 12:98906415-98906437 CCCCAGGAACATGGGGCTCTCGG - Intronic
1104388369 12:128370606-128370628 CACCAAGAAAAGGGGGAACTTGG + Intronic
1104747160 12:131218041-131218063 CCCAAGGAAAAAGTGAACCTCGG - Intergenic
1110365626 13:74681851-74681873 CCCGAGGAATATGGAGACCTTGG - Intergenic
1114668867 14:24398586-24398608 TCCCAAGAGAACGGGGACCTCGG - Intergenic
1117480382 14:56137963-56137985 CCCAAGGGAAATGTGCACCTGGG - Intronic
1117481606 14:56151246-56151268 CACCAGGTAAATGGGGGCCGAGG - Intronic
1119176389 14:72570686-72570708 CCCCAGGGACATGGGGATCCAGG + Intergenic
1120017131 14:79486764-79486786 TCTCAGGAAAATGGGGACTGAGG + Intronic
1120960983 14:90124582-90124604 CCACAAGGAAACGGGGACCTCGG + Intronic
1122064968 14:99166521-99166543 CACCAGGAAAATGAGGACCAGGG - Intergenic
1122886449 14:104712548-104712570 CTCCAGGCAAGTGGGCACCTGGG + Exonic
1202835862 14_GL000009v2_random:76960-76982 ACCCTGGAAAAGTGGGACCTGGG - Intergenic
1125540340 15:40466422-40466444 CCTGAGGGAAATGGGGCCCTAGG + Exonic
1125854964 15:42939815-42939837 CCCCAGGGCAATGCGGATCTTGG - Intergenic
1125875505 15:43140658-43140680 CCCCAGGGCAATGTGGATCTTGG - Intronic
1128338649 15:66804524-66804546 CTACAGGATAATGGGGATCTGGG + Intergenic
1129616003 15:77099056-77099078 CCCCAGAAGCATGGGGGCCTTGG - Intergenic
1130978429 15:88795019-88795041 CAACAGGAAAGTGGGGAACTGGG - Intergenic
1130992831 15:88886867-88886889 CCCCAGTGGAAAGGGGACCTGGG - Intronic
1131873048 15:96780104-96780126 CCCAAGGGAAGTGGGCACCTGGG + Intergenic
1132041007 15:98524657-98524679 CCCCAAGAAGATGCTGACCTTGG + Intergenic
1132368318 15:101274575-101274597 CCCCAGGTGACTGGAGACCTCGG - Exonic
1132781701 16:1630066-1630088 CCTCAGGGAAATGAGAACCTGGG - Intronic
1133028472 16:2998663-2998685 CCCCAGGAGAGTGTGGACCAAGG + Intergenic
1133036312 16:3036147-3036169 CCCGTGGAAAATGGGGACTGGGG - Intronic
1133667150 16:7979668-7979690 CCTCAGTGAAATGGGGACCGAGG - Intergenic
1134630061 16:15750021-15750043 CACATGGAAAATGGGGTCCTCGG + Intronic
1139358604 16:66382399-66382421 CCCCAGGAGAATGCCGCCCTAGG + Intronic
1139682373 16:68575037-68575059 CCTCAGGAAAATGTTGAACTGGG + Intronic
1139961781 16:70722115-70722137 TCCCAGGAGAGTGGGGGCCTTGG - Intronic
1141633401 16:85301247-85301269 GCCCAGGAAAGTGGTGCCCTTGG + Intergenic
1142598171 17:1039698-1039720 CCCCAGGCACATAGGGACCGTGG - Intronic
1143057869 17:4175936-4175958 CCCCAGGAAGGCGGGGTCCTTGG + Intronic
1143381049 17:6496545-6496567 CCCCAGGAAAGAGAGGACCGTGG - Intronic
1143771738 17:9173401-9173423 CACCAGAGATATGGGGACCTGGG + Intronic
1143902542 17:10184873-10184895 CTCCAGGAAAAGGGGGGCCATGG + Intronic
1144264557 17:13555498-13555520 CCTCAGGGATCTGGGGACCTTGG - Intronic
1144812299 17:18008198-18008220 AGCCAGGCACATGGGGACCTAGG - Intronic
1145728904 17:27157740-27157762 CCACAGGAAAATGAGGCTCTGGG + Intergenic
1145765429 17:27456030-27456052 GCCCTGGAAGATGGGGACCAGGG - Intergenic
1148021201 17:44555213-44555235 CCCAAGGCAGATGGGGAGCTGGG - Intergenic
1151472163 17:74325365-74325387 CCCCAGGAAACTGAGGCCCCAGG + Intergenic
1151632506 17:75320495-75320517 CCCCAGGAGGATGGAGAGCTGGG - Exonic
1151961704 17:77409149-77409171 CCCAAAGTAAAAGGGGACCTGGG - Intronic
1152286208 17:79414708-79414730 CCCCAAGAGGATGGGCACCTGGG + Intronic
1152861854 17:82701016-82701038 CCTCAGGAAACTGGGGGCCCTGG - Intergenic
1152918390 17:83053021-83053043 CCCCAGGAGAAGGGGTGCCTGGG + Intergenic
1154434883 18:14335610-14335632 TCCCTGGAAAAGCGGGACCTGGG - Intergenic
1158832624 18:61297010-61297032 GTCCAGGAAAATAGGGTCCTGGG + Intergenic
1160076202 18:75680038-75680060 CTCCAGGATGATGGGCACCTGGG + Intergenic
1160334748 18:78028998-78029020 CTCCAGGAATTTGGGAACCTGGG - Intergenic
1160914074 19:1488395-1488417 CCCCAGGCACATGGGGACCCTGG - Intronic
1161182046 19:2890133-2890155 CCCCAGGAACTTGGGGACAGAGG + Intergenic
1161666421 19:5579752-5579774 AGGCAGGAACATGGGGACCTGGG - Intergenic
1161708014 19:5831296-5831318 CCCCAGGAAAGTGAGGACCCAGG + Exonic
1161708047 19:5831441-5831463 CCCCAGGAAAATGAGGTTCCTGG + Exonic
1162109040 19:8390407-8390429 CGCCAGGACAATGGGGACCCGGG + Exonic
1162962379 19:14135947-14135969 CCCCATGAAAACGGGTACCTAGG + Intronic
1163654489 19:18537890-18537912 CCCCAGGAAAGCGTGGCCCTTGG - Intronic
1163689474 19:18730781-18730803 CCCCAGGAGTAGGGGGACCAAGG - Intronic
1163784195 19:19266286-19266308 CCCCATGAAAATAGGGACAGGGG - Intronic
1164336089 19:24322784-24322806 CACCAGGGAAATGGGGACTGGGG + Intergenic
1165700428 19:37933146-37933168 CACAGGGAAAATGGGGGCCTGGG - Intronic
1166762160 19:45231824-45231846 GCCCTGGAGAATGGGGAGCTGGG - Exonic
1166779705 19:45335051-45335073 CGTCAGGAAAATGGGTACATAGG - Intronic
1167156700 19:47743177-47743199 CCCCAGGGAAAGAGAGACCTGGG + Intergenic
1167494026 19:49807588-49807610 CTCCAGGAAAATGGGGGCCAAGG - Intronic
1167688620 19:50971502-50971524 CCCAAGGGAGATGGGGACCCAGG - Intergenic
1168642220 19:58038106-58038128 GCCCAGCAAGATGCGGACCTGGG + Exonic
1202636775 1_KI270706v1_random:50403-50425 ACCCTGGAAAAGTGGGACCTGGG + Intergenic
925499229 2:4485670-4485692 CCTCAGGATAATGGGGAACATGG + Intergenic
926057289 2:9781365-9781387 CGCCAGGAAAATGGGGTTCCCGG + Intergenic
926367422 2:12145909-12145931 CAGCAGGAGAAAGGGGACCTGGG + Intergenic
926584001 2:14665280-14665302 CCCCAGGAAACTGGGCCTCTTGG - Intergenic
926729147 2:16021925-16021947 CCACAGCACAATGGTGACCTTGG - Intergenic
929158621 2:38810410-38810432 CCCCTGTACAATGGGGAGCTAGG - Intronic
929254423 2:39794086-39794108 GCCCAGGACTATGGAGACCTTGG - Intergenic
929307455 2:40379759-40379781 CCCAAGGAAAATGTGGCTCTGGG - Intronic
929858512 2:45655163-45655185 CCAGAGGAAAATGAGGCCCTGGG + Intronic
931635896 2:64340616-64340638 CCACATAAAAATGAGGACCTGGG + Intergenic
932546154 2:72712518-72712540 CAGCAAGAAAATGGGGACTTTGG - Intronic
933012658 2:77087916-77087938 CCTCTGGAAAAAGGGAACCTTGG - Intronic
935072591 2:99708482-99708504 CCCCAGGCAACATGGGACCTTGG + Intronic
935492697 2:103740143-103740165 CCACAGGAAAATGAGGGCCCAGG + Intergenic
935544304 2:104384578-104384600 CCCCAGGAAGATGCCTACCTGGG - Intergenic
936502134 2:113074762-113074784 CCCCAGGAAAATGGGGACCTTGG - Exonic
936531559 2:113279731-113279753 CCTCAGCAATATGGGGGCCTGGG + Intergenic
939832537 2:147089905-147089927 TGTCAGGAAAATGAGGACCTTGG - Intergenic
939954434 2:148514700-148514722 ACTCAGGAAAATGGAGACCAAGG + Intronic
941180624 2:162254919-162254941 CCCCAGGAAGGTGAGTACCTTGG + Intergenic
942131961 2:172888919-172888941 CCCCAGGAAGATGGACAACTGGG - Intronic
943169806 2:184384508-184384530 CGGAAAGAAAATGGGGACCTTGG - Intergenic
945158348 2:206862521-206862543 CCCCAGGAAGCTGGGGGACTTGG + Intergenic
946077761 2:217089238-217089260 CCACAGGAGAATTAGGACCTGGG + Intergenic
946138362 2:217666771-217666793 CCCTGGGAAGATGGGCACCTAGG + Intronic
946241257 2:218357358-218357380 CCCCGGGGACATGGGGACATGGG + Intronic
946965048 2:225028357-225028379 CAGCAAGAAAATGGGGACCTCGG + Intronic
947048101 2:226011177-226011199 ACCCAGGAAAATGGGCATATAGG + Intergenic
947258080 2:228188776-228188798 CAGCAAGAAAATGAGGACCTCGG - Intergenic
947857527 2:233334130-233334152 CGTCTGGAAAATGGGGATCTTGG + Intronic
947864116 2:233384378-233384400 GCCCAGGGAAATGGGAACCCAGG - Intronic
1170264084 20:14445504-14445526 AACCAGGAAAATGGGGAATTGGG - Intronic
1172329844 20:34067850-34067872 CCCCAGGACACTGAGGAGCTGGG - Intronic
1172948012 20:38703521-38703543 CCCCAGGAAAAGACGGGCCTGGG - Intergenic
1173478777 20:43382987-43383009 CCCCAGAAAAGAGGGGAGCTGGG - Intergenic
1176110182 20:63407499-63407521 TCCCAGGAAACGGGGGACCCAGG + Intronic
1176110221 20:63407611-63407633 TCCCAGGAAATGGGGGACCCAGG + Intronic
1176271908 20:64239704-64239726 CCCCAGGAGGATGGGGGCCAAGG + Intronic
1176842153 21:13850092-13850114 ACCCTGGAAAAGCGGGACCTGGG + Intergenic
1177661917 21:24095774-24095796 CCCAAGGAAAATGGGGATTCAGG - Intergenic
1179346277 21:40560413-40560435 CCCCGGGAACATGGGGAACGTGG - Intronic
1179823867 21:43952903-43952925 CCCCAGCACCCTGGGGACCTTGG - Intronic
1180064130 21:45404579-45404601 CCCTGGGAACAGGGGGACCTGGG + Intergenic
1180070792 21:45435084-45435106 CCACAGAAGAATGGGGACCAGGG - Intronic
1180364096 22:11923910-11923932 ACCCTGGAAAAGTGGGACCTGGG - Intergenic
1181265227 22:21627207-21627229 CCCCTGTAAAATGGGGACATCGG + Intergenic
1181339433 22:22166213-22166235 CCCCGGGAGAGTGTGGACCTGGG - Intergenic
1184288686 22:43486711-43486733 CCCCGGGAAATGGGGGCCCTGGG + Intronic
1184601045 22:45543557-45543579 CCCCAGGAGGAAGGTGACCTGGG - Intronic
1184611862 22:45609171-45609193 GCCCTGGAGAATGGGTACCTTGG + Intergenic
1184743607 22:46443374-46443396 CCCCAGGGAAATGGGAACAGAGG + Intronic
1185048451 22:48541005-48541027 CCAAAGGAAAATGGGGATCCTGG + Intronic
1185066490 22:48634980-48635002 CCTCAGGAAAATGGCTCCCTGGG - Intronic
949995447 3:9612932-9612954 CATCTGTAAAATGGGGACCTTGG - Intergenic
950043040 3:9932714-9932736 CCCCAGGGGAATGGGGAGCCGGG - Intronic
950264255 3:11562787-11562809 TCCCAGGAAAATGGGCAGCTTGG + Intronic
951007044 3:17629746-17629768 CAACAAGAAAATGGGGGCCTGGG + Intronic
951084567 3:18496318-18496340 TCCAAGGAAAATGGGCAACTTGG - Intergenic
951123343 3:18955230-18955252 CCTCTGGAAAATAGGGTCCTAGG - Intergenic
951460780 3:22949427-22949449 CATCAGGAAAATAGGGATCTTGG - Intergenic
953086592 3:39674353-39674375 GACCAGGAAAATGTGGACCCAGG - Intergenic
953749946 3:45601359-45601381 GCCCAGGAAGATGGTGACTTTGG + Intronic
953876095 3:46667714-46667736 CCCCAGGGAAATGGAGCCCCGGG - Intergenic
954407587 3:50354133-50354155 GCACAGGAAAATGGGCAGCTGGG + Intronic
954417907 3:50403060-50403082 CCCTAGGAACTTGGGTACCTTGG - Intronic
954475272 3:50738340-50738362 CCCCATGAAACTGTGGGCCTGGG - Intronic
955986285 3:64576949-64576971 CCCCAGGAATATGGGGGACAGGG + Intronic
956749458 3:72334600-72334622 CCCCAGGATGCTGGGGACTTTGG - Intergenic
956788844 3:72664966-72664988 ACCAAGGAAGATGTGGACCTAGG - Intergenic
961074637 3:123970684-123970706 CCCCAGGAAAATGGAGTCCCAGG + Intronic
961309049 3:125981802-125981824 CCCCAGGAAAATAGAGTCCCAGG - Intronic
961366387 3:126402398-126402420 CCCGAGGGAAAGGGGGACGTGGG + Intronic
962757010 3:138472698-138472720 GCCCTGGAGAGTGGGGACCTGGG - Exonic
965167007 3:165207280-165207302 CACCAGGATCATGGGGACTTGGG + Intergenic
966121585 3:176527832-176527854 CCCAAGGGAAAAGGGAACCTTGG - Intergenic
966198571 3:177338224-177338246 ACCCAAGAAAATGGGCACTTAGG - Intergenic
967973516 3:195016982-195017004 CCCCTTAAAAATGGGGTCCTAGG - Intergenic
967976978 3:195040950-195040972 CCCCAGGAACCTGGGGAGCCTGG - Intergenic
969227774 4:5810374-5810396 CCCCAGGAAAGAGGGGACCTGGG + Exonic
970781949 4:19748116-19748138 CTCCAGGAAAATGAAGAACTGGG + Intergenic
971024557 4:22575873-22575895 CCTAAGGCAAATGAGGACCTTGG - Intergenic
971456049 4:26845149-26845171 CCCCAGGACATCAGGGACCTTGG - Intergenic
971969634 4:33604812-33604834 GCACAGGAAAGTGGGGCCCTGGG + Intergenic
973394029 4:49578662-49578684 ACCCTGGAAAAGCGGGACCTGGG - Intergenic
976564120 4:86533917-86533939 AAACAGGAAAATGGGGACATTGG - Intronic
980099841 4:128530719-128530741 CCCCATGAAAAAGGGGACAAAGG - Intergenic
980977072 4:139621363-139621385 CCCCAGGAAGATGGGGACTGGGG - Intergenic
981744581 4:148040183-148040205 CCCCAGGCAAGTGGGGAACTTGG + Intronic
982080610 4:151786089-151786111 CCCCAGGCAGATGGATACCTTGG + Intergenic
983004322 4:162465234-162465256 GGCAAGGAAAATGGGGACATAGG - Intergenic
983963736 4:173785720-173785742 TTGCAGGAAAATGGGTACCTAGG + Intergenic
984612425 4:181856264-181856286 CCCAAGGAAATCTGGGACCTTGG + Intergenic
984879706 4:184399647-184399669 ACCCAGCTAGATGGGGACCTTGG - Intronic
985766451 5:1782138-1782160 GCCCAGGAGATTGGGGAACTTGG - Intergenic
987017690 5:13836999-13837021 ACCTAAGACAATGGGGACCTGGG + Intronic
987756792 5:22107027-22107049 CCCCAGTAGAATGGGTAGCTGGG - Intronic
989318197 5:40106048-40106070 CACCAGGGAAATGGGGAGCGGGG + Intergenic
989775056 5:45196227-45196249 CCCCAGGAGAATTGGGAGGTGGG + Intergenic
990199648 5:53357100-53357122 CTCAAGGAATATGGAGACCTAGG - Intergenic
990329789 5:54714335-54714357 CCCCAGCAAACTGGGGACAGAGG + Intergenic
992615657 5:78543675-78543697 CCCCAGGATACAGGGGACCAAGG + Intronic
992632405 5:78694710-78694732 CCCCAAGAAAAATGTGACCTTGG - Intronic
994224168 5:97232788-97232810 CGCCAGGAAAAGGGGAACATGGG - Intergenic
996806556 5:127462120-127462142 TCTGAGGAAAATGGTGACCTGGG + Intronic
997355477 5:133260125-133260147 CCCCAGGAAACTTGGGACGACGG - Intronic
997726033 5:136120466-136120488 CCCCAGGAACATGGGGAACATGG - Intergenic
997825931 5:137106811-137106833 CCCCTGCAAAATGTGGCCCTTGG + Intronic
998328885 5:141305929-141305951 CCCCAGGAAAGTGAGGAGCGTGG - Intergenic
999862707 5:155665740-155665762 CCACAGGAAAATGGGCAGGTGGG + Intergenic
1001241119 5:170070531-170070553 CCCCAGAAGGCTGGGGACCTGGG - Intronic
1001709359 5:173765550-173765572 CCCCAGGAATCTGGGAAACTTGG + Intergenic
1002641547 5:180632947-180632969 CCCCAGGAGGACAGGGACCTGGG - Intronic
1004773348 6:18812227-18812249 CCCCAGGAGGATGAGAACCTGGG + Intergenic
1004814063 6:19293506-19293528 ACTCAGGACAAAGGGGACCTTGG + Intergenic
1005968433 6:30743065-30743087 CTCCAGGAAAAGGGGCTCCTGGG + Intergenic
1006035087 6:31205106-31205128 CCCCATGAAACTGAGGCCCTAGG - Intergenic
1006096743 6:31660913-31660935 ACCCGGGAAAATGGGGAGCTGGG - Intergenic
1006873052 6:37270780-37270802 CCCCAGGAAGATGAGAACCTAGG - Intronic
1007284438 6:40737495-40737517 CCACAGCAAAATGGAGACATTGG + Intergenic
1008734465 6:54526175-54526197 CACCATTAAAATGGGCACCTAGG - Intergenic
1010117098 6:72326738-72326760 CCTCAGAAAAATGGGGAATTGGG + Intronic
1011042944 6:83051263-83051285 GAGCAGGAGAATGGGGACCTGGG - Intronic
1011807423 6:91087976-91087998 CCCAAGGACAAAGGGGACTTTGG - Intergenic
1012780261 6:103548422-103548444 CCCCATGAAAATCGGCACCAGGG - Intergenic
1013751223 6:113408892-113408914 CCACAGGGAAATCGGGTCCTTGG - Intergenic
1014106084 6:117563336-117563358 ACACATGAAAATGGAGACCTGGG - Exonic
1015216407 6:130755374-130755396 CCCCAGTGAAATGGGGGCCTAGG - Intergenic
1018924365 6:168195945-168195967 ACAGAGGAAGATGGGGACCTCGG - Intergenic
1019539496 7:1545427-1545449 CACCAGGAACAGCGGGACCTGGG - Exonic
1021695227 7:23269738-23269760 CCTCAGGAAAGTGAGGCCCTGGG - Intronic
1022258930 7:28685482-28685504 CTCCAGGAAAAAAGGGCCCTGGG + Intronic
1022958396 7:35402073-35402095 CATCTGGAAAATGGGGACATTGG - Intergenic
1023943481 7:44785231-44785253 CCCCAGGAACCTGGAGAACTGGG + Intergenic
1025810212 7:64870846-64870868 CCTCAGGACAATGAGTACCTGGG - Intronic
1027247383 7:76376351-76376373 CCCCATAGAGATGGGGACCTGGG + Intergenic
1029274376 7:99395600-99395622 TCTCAGGAAAATGTGGGCCTTGG + Exonic
1030155283 7:106448573-106448595 CCCCAGGGAATTGGCCACCTTGG + Intergenic
1030192577 7:106824283-106824305 CTTCAGGACAATGGGGACCTTGG - Intergenic
1030673725 7:112364144-112364166 CCCCAGGAAGAGTGTGACCTTGG + Intergenic
1031567086 7:123313792-123313814 CCCCATTAAAATGGGCCCCTGGG - Intergenic
1031972819 7:128076282-128076304 CACCAGCAAAATGGTGACTTGGG - Intronic
1032283624 7:130525360-130525382 GCCCAGGAATATGCGGAACTAGG + Intronic
1032541339 7:132705622-132705644 CCACAGGGAAATGGGAACCAGGG - Intronic
1033229389 7:139584461-139584483 ACCCAGCAACCTGGGGACCTGGG + Intronic
1033759485 7:144423757-144423779 CCCCAGGACAATGGGGCTTTGGG + Intergenic
1034488328 7:151380151-151380173 CCCCAGGAAAATGGGCCTGTTGG - Intronic
1035359310 7:158299856-158299878 ACCCAGCAAAATGAGCACCTTGG + Intronic
1035563855 8:628490-628512 CCCCAGGCAGCTGGCGACCTTGG + Intronic
1037838235 8:22227167-22227189 TCCCAGGAAAATGGTGGCCAGGG - Intronic
1039398348 8:37246846-37246868 CCCCATGAATATGGGGTACTAGG - Intergenic
1041234114 8:55781610-55781632 CCCCAGGAACATGGGCACTGGGG - Intronic
1041271282 8:56111697-56111719 CCCTAGGAAAAAGGGGACTGGGG - Intergenic
1042460910 8:69067235-69067257 CTCCAGAAAAATGCTGACCTTGG - Intergenic
1045607936 8:103799085-103799107 CAGCAAGAAAATGGGGACCTTGG + Intronic
1046609278 8:116405967-116405989 AATTAGGAAAATGGGGACCTCGG - Intergenic
1048284400 8:133130563-133130585 CAGCAGGAAAACGGGGGCCTGGG + Intronic
1049024474 8:139979289-139979311 CCCCAGGAAGGAGGGGTCCTGGG + Intronic
1049102738 8:140590842-140590864 CCCCAGGGCAAAGGGGCCCTAGG - Intronic
1049663872 8:143834353-143834375 CAGCAAGAAAGTGGGGACCTTGG + Exonic
1051360052 9:16274083-16274105 AGCAAGGAAAATAGGGACCTTGG + Intronic
1051972472 9:22906875-22906897 CCCCAGAAATATGGTGTCCTAGG + Intergenic
1052295127 9:26889552-26889574 TCCCAAGAAAATAGGGAACTCGG + Intronic
1053150306 9:35739001-35739023 CCCCATGATATTGGGGACCCAGG - Exonic
1053461822 9:38277287-38277309 ACTCAGGAAAATGGGAACTTTGG + Intergenic
1055080202 9:72261305-72261327 CCACAGGCAAATGGGAACCTTGG - Intergenic
1056580814 9:87887153-87887175 TCCCAGGAAAATGGGAACCTTGG - Exonic
1056737964 9:89225919-89225941 CCTCTGGAAAATGGTGACCCAGG - Intergenic
1057211980 9:93205438-93205460 CCCCAGGAACAAGGGGGCCCAGG - Intronic
1058676608 9:107405570-107405592 CCCCTGGCATATGGGTACCTGGG - Intergenic
1059390844 9:113998806-113998828 CCCCAGCAAAAAGAGGACCATGG - Intronic
1060185385 9:121560993-121561015 CAGCTGGAAAATGGGGAGCTGGG + Intergenic
1061005707 9:127927589-127927611 CCCCAGGTATATGATGACCTAGG + Intronic
1062383172 9:136297511-136297533 TCCCAGGCAACTGGTGACCTTGG - Intronic
1186541835 X:10409002-10409024 GCCCAGAAAACTGGGGACTTAGG - Intergenic
1187438014 X:19290299-19290321 CCCCATGACAATGATGACCTGGG - Intergenic
1189497458 X:41521996-41522018 TTCCAGGAAATTGGGGCCCTGGG + Intronic
1189586576 X:42468020-42468042 ACCGAGGAAAAGGAGGACCTTGG + Intergenic
1189776720 X:44476527-44476549 CCCCAGGGCAATGTGGATCTTGG - Intergenic
1190117446 X:47635813-47635835 CCGCAGGAAATTGGGGGGCTGGG + Exonic
1195711477 X:107776418-107776440 CCCCAGAAAAAGGGGGGCTTTGG - Intronic
1196693985 X:118591233-118591255 CCCCATGAAACTAGGGACATTGG - Intronic
1196910722 X:120481902-120481924 CCTCAGGAAAATGGGGAATTGGG + Intergenic
1198186818 X:134261057-134261079 TCCCAGGAAAAGTGTGACCTTGG + Intergenic
1199001776 X:142647376-142647398 CAGCAAGGAAATGGGGACCTTGG + Intergenic
1199257410 X:145732454-145732476 TCCAAGGAAAATGGAGACCTGGG - Intergenic
1199615394 X:149651696-149651718 TCCCAGGAAGATGGTGGCCTTGG - Intergenic